Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20347  (registered. 2007)
Contig Information
Length 854 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0671200 [Oryza sativa (japonica cultivar-group)] >gi|32488409|emb|CAE02834.1| OSJNBa0043A12.39 [Oryza sativa (japonica cultivar-group)] >gi|90265248|emb|CAH67701.1| H0624F09.9 [Oryza sativa (indica cultivar-group)] >gi|113565789|dbj|BAF16132.1| Os04g0671200 [Oryza sativa (japonica cultivar-group)] >gi|125550177|gb|EAY95999.1| hypothetical protein OsI_17870 [Oryza sativa Indica Group] >gi|125592017|gb|EAZ32367.1| hypothetical protein OsJ_015850 [Oryza sativa (japonica cultivar-group)]
Score 658
Evalue 5.61377e-67
Total Hit Count 416
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20347
ATCATACGTACAAGACTCAGTACCCAAATGTCACTTGTCTAAAATTTATTGATTGATCGGACATAACAAATTGGTAACGCTATAAATCAAGTGTCCACAG
ATGCACAGCAGCACAGGCATCGCATCAAATGTTCCTTGATCCAAAGCAACACGAGAAAATAGAAGATGTGAAAAAAAAGGAAATCTGAATTCAATCTTGC
GTTCTGCCGACTCGGACTGATCGACTGCACATTGATCGGCTTCTGTCAATCATCAGACCAATCGGGCATGGCAGAACGCAGCTGTATCGAAGAATCATCT
CTAGGTGCGGCAAATCTGGAGAGGGGCGACGACGTCGGCCATCTCTTCGCAGGCGGCGGCGCCGACCTGGACGAGGTCCGGAACGCCCTTCCTCATCAGC
AGCCTCCTCCGGCATTCCTCAGCGGCGTCCATGCCTGACGAGTATGCGCCGTGCACAGCTCCCGAGTGCTCCGCGCTGGCCGCCTCTCCAGCGAAGTACA
GCACGCTCTCCACCGGCGCCGAGAACCTCTCGCACACGTCCGACGGCTTCCCCACCAGGTCGCACGAGTAGGACCCCAGCGAGTTCGGGTCCGAGCCCCA
CCGCGATACCAGGTACTGACTGGGTTCAGTGGCGTCGGGTATCATCTTCCTCAGGTGACACATGACGAGTTCCACGGCCTCCTTGTCTGAGAGCTTCTCC
ACATCCTGGGCGAACCGACCGGCTGCCATGAAGACGAGCACCGGGTGGCCAGTGGCCTTGTGGAGGTTCAGGAAGTANCCGCAGGTCTTCGGCGTANGGC
CGACCATGCCCANCACCTGGACATTANGCCANAAGGCCTTGTCNAANTGCATGG
page-top