Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20311  (registered. 2007)
Contig Information
Length 1148 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit peptide transporter PTR2 [Zea mays]
Score 1209
Evalue 1.14562e-130
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20311
CAGATGATCACAATGGTCCTTGAAGAGCTGCAGCGGACAGATGGCTTTCGGTAAGTACTAAGTACTCTAGCTCCTGCCAAATCTGAAGAACAGCCCTGAA
ATATACGTACTTGGCTGAAGCTAAAGCTTCCTACAGGTGCCTGGAGAAATCGGTGGTAGAGACCGGAGAGACAGGGCCATGGTCGCTGTGCACCGTGACC
CAGGTGGAGGAGACCAAGATCGTCCTCCGGATGGTGCCCATCTTCCTCAGCTCCGTCCTCGGATACATCCCGGTGCCGCTCATCCTCAACTTCACCGTGC
AGCAGGGGAACACCATGGACACCAAGCTCGGCGGCGTCCACATCTCCCCGGCCACGCTCTTCGTCATCCCCACCGTCTTCCAGATGGTGATCCTCGTCCT
CTACGACCGGTTCATCGTCCCCTTCCTGCGCAGGATCACCGGATACGTGGGCGGCGTCACGCATCTGCAGCGCATCGGGATCGGGTTCCTCTCGGCCACC
GTGGCCACCGGCGTCGCCGCCCTGGTGGAGGCCAAGAGGAAGAGGGTCGCGGAGGAGAACGGCCTCATGGAAGCCACCACCGGGATCCCCATGTCCGTCT
TCTGGCTGACGGTGCAGTTCTTCCTCCTCGGGGTGGTGGACGTCACCTCCTTCGTGGGGCTCCTCGAGTTCTTCTACAGCGAGGCGTCCACGGGGATGAA
GTCCGTCGGCAGCTCCATCTTCTACTGCATCCTCGGGGTGTCGGCTTGGCTGGGGAGCCTGCTCATCCAGGTGGCCAACCGGGTCACCAGGCGCGCCGAC
GGGACGGGAGGCTGGCTGGACGGCACCAACTTGAACATGGGCAAGCTCGACAACTTCTACTGGCTGCTTGCTGTGCTTGAGCTGGTGTCGCTCTTCGTCT
ACACCTTCTTCGCCAGGAGGTATGTGTATAGGAATGAGCAAAGGGTTGTGGATGTGGACACCAAGGTTCCAATGGAAGGTGCCACCTTTGGTGATGTGAT
GATCTAGACTAGACTAGATGATGATACACGACCAAACTAGACAATGCCAACTTCAATTGTGACGTACAAGTACCAACTACCACTCAGTGTTTTGACTGGA
CCAATGTGGATGGGCCGGGATGTTATATGACTCTTTTTGAGCGTTCAC
page-top