Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20292  (registered. 2007)
Contig Information
Length 709 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 1
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 1
Wh_VWD Shoot grown with dessication 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit geranylgeranyl hydrogenase [Triticum aestivum]
Score 755
Evalue 2.22724e-78
Total Hit Count 462
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20292
ATCGAATATTGGCGTGCTTCACAATCCAGACGAACTGCTCTGAAGTCTGAACATCACCGTGCATGCGTACGTTGTACTACAAGAAAACCGGACAGGATCG
ACCAAGACACGACCTCTCGATCGACGCCATTACCTTATTCTCATCTCCTCTGCCTCAAATCCGTTCGATCAGCCGCGGATCTCTGCTATACCGACCGATC
CGCCGCAGCTTCGAGCGACCCAAGCAGGCTGTCAGGAACGTTTCCGGCGGGTCGGCGATCACAAGGTGAGCTTCCCCATCTCCCGGCGCAGCGCGGTGGC
CCTGACGAGGCTGCCGATGGTGTTGACGGCGAGCTTGATGTCCTCGATGGGGTTGCCCGGCACGACGCGCTTGTAGAGGTAGCTGTCGAAGGTCATCCGC
TGCACGTAGTCGTCGGCGCACATCTCCACGAACGCCTCCCGCGCCGCGTTGGAGCGGTAGAACACCTTCTGCAGGATGTCCAGCACCTTGTACGTCGGCC
AGTAGAGCCGGTCGAACTCCGCCAGGTACTTGCGCAGGTCGCTCTCGTCCACCAGCCGCGTCCCGTTCGCCGACCCGGCCACGATCGCCTCCGCGCACAT
CCGCCCGCTCTTCGCCGCGAAGTAGATCCCCTCGCCGGAGCACTTGGTCACGTACCCCGCCGCGTCGCCCACCAGCGTCACCCGCCCCGACACCCTCTTG
GGCCTGGGG
page-top