Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20183  (registered. 2007)
Contig Information
Length 1145 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 4
Wh_PCDAM Anther at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit TATA-box-binding protein 1 (TATA-box factor 1) (TATA-binding factor 1) (TATA sequence-binding protein 1) (TBP-1) (Transcription initiation factor TFIID TBP-1 subunit) >gi|21875|emb|CAA42531.1| TATA binding protein (TFIID) [Triticum aestivum]
Score 988
Evalue 4.82701e-105
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20183
CGACACCCCGTCGAACCCTAACCCGCACCCTGATCCGCCGCCGCCACCGCCTCCACCACCAGCCCACCGAAGCCTCCCACCGTTCCATTCGCTTCCCTCC
CACCGCTTCCTCCTCCTCATAAAGCCTGCCCCGTTCGAAAATCTTTGCCTCCAGATCGTGATCCTGCGGCAGTTCTTGGATCGCCAGATCGATCGGATGG
CTGCCGCGGGCGGTGGACCCGATGGTGCTTGGGCTGGGAACGAGCGGAGGTGCGAGCGGGAGCGGAGTGGTAGGAGGCGGTGTTGGGAGAGCAGGAGGAG
GGGGTGCGGTGATGGAAGGGGCGCAGCCGGTGGATCTCGCCAGGCACCCCTCCGGCATCGTCCCCGTCCTCCAGAACATTGTGTCGACTGTTAATCTGGA
CTGCAGGTTGGATCTGAAACAAATTGCCTTACAGGCCCGTAATGCAGAGTACAACCCAAAGCGTTTTGCAGCGGTTATCATGAGGATAAGGGACCCCAAG
ACGACAGCTCTTATATTTGCTTCAGGAAAGATGGTATGCACTGGAGCAAAGAGTGAAGAACACTCGAAGCTTGCTGCCAGGAAGTATGCACGAATTGTCC
AAAAGCTTGGCTTCCCAGCTACATTCAAGGACTTCAAGATCCAGAACATTGTTGCCTCATGTGACGTGAAATTTCCCATTCGTCTCGAGGGCCTTGCTTA
TTCCCATGGCGCCTTCTCCAGTTATGAGCCAGAGCTCTTTCCTGGGTTGATTTACCGTATGAAACAGCCAAAGATTGTCCTCCTTGTATTTGTCTCTGGA
AAGATTGTTCTCACGGGAGCTAAGGTGCGGGATGAGATATATGCTGCCTTTGAGAACATCTACCCGGTGCTAACTGAGTACAGGAAATCTCAGCAATGAG
GGGAGGATCCATCAGCTAAAGTGGGAGTTCCCTGCTTCTTCTGTACATAGAAAACTAAAAAGATCTGACTGCGTCTCTTCTCTCTCTTTTAACTTCTTAC
TGCCAAGAACTAGGTTTAGAATGCCAAGTACTCGTAGAAAAAGATTGTATTCTTTTCATAACCGGGAGCCGACAAGCAACTGTGGTATGTTAAGAGATCA
TGTTTATCTGTAAATACATGACTCAATTTTGCTCTAGTTCTCTAT
page-top