Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20126  (registered. 2007)
Contig Information
Length 1306 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_V483 Shoot grown under cold condition for 3days 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0471500 [Oryza sativa (japonica cultivar-group)] >gi|47497428|dbj|BAD19485.1| putative protein phosphatase 2C [Oryza sativa Japonica Group] >gi|47497536|dbj|BAD19608.1| putative protein phosphatase 2C [Oryza sativa Japonica Group] >gi|113536366|dbj|BAF08749.1| Os02g0471500 [Oryza sativa (japonica cultivar-group)] >gi|215767865|dbj|BAH00094.1| unnamed protein product [Oryza sativa Japonica Group]
Score 516
Evalue 2.60318e-90
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20126
CAGTGGCAGTGCTCAAACAGGGTCATAATCTTATAATAGGCAACTTGGGAGACTCAAGAGCTATCTTAGGCACTAGAAATGAAGATGGTCAGCTCATTGC
TGTCCAGTTGACAGTTGATCTCAAACCTAACATTCCAAGTGAAGCACAACGGATCAGGCAACGCAGGGGCAGAATATTTGCACTTCCTGAGGAGCCAGAG
GTTGCTCGTGTTTGGCTGCCAAAGTATAACTCACCTGGATTGGCCATGGGCAAGGGCATTTGGAGACTTCTGTCTTAAGGAGTATGGTCTAATTTCTATG
CCTGAAGTCTCCTGTCACCGTGTCACAGAGAAGGATGAATTTATTGTGTTGGCGACTGATGGGGTGTGGTATGTGCTGTCAAACACTGAAGTTGTTAGCA
TCATAAGCAGAGCCACTTCTCGGGCTTCCGCAGCACGCTTCCTGGTTGAATCAGCTAATCGTGCCTGGCGTACTAGGTACCCTACTTCTAAAATTGATGA
CTGTGCTGTTGTTTGTCTCTTCCTGAATACACATGAAGCAGATGAACCATCTAGTTCTGCAGCCAACAATTTAGCAAATGCTCTAGAAGTTAGTGGTGAT
AAGCACTCGACAGTTGTCCAACTGAGCACTGGAGTATCTGCCGATGTGGTTAATGCACTTGTGAAAGATACAAATGAGCTATCTTTTGTTGATGCTGTTG
CGAAGCCAGTTACTGTCTCAGATTTGACAAAGGATGGTTCAGGCACAAAGCAAAGCATCATTTGAGCTTGTGTGTTGCATGAGATTGAACATTTGTTGGG
CGATTTGTGCTGTGTTGACAGTGCGCTCCCATTCTCCCATTCAGAATTCTGAGCCTGATGCCTATTTTTATGAGCGCGTTGAAATTCACTGCTTGCTATT
TTCTACATGCAAGTCCGAGTAGGGTCTTGAGTTTTCGTCATTTGTGAAGTACCACTTCGGTTTTGGTGTGACCTGCCATATTTCTTTGTAATAATTTTGT
TCTTAATGTTTGTTTAGTCTCGTAACAATAATAGTATCCCTATAGGAAGAAGCCTTCCGTGTTTTCACAGTTCTGTAATATTCATTCGATTGCCGTCCAT
TACAGTGGCTGTTATGCATTTCAACTTTTGGTCCTCTGTACACAATCGCATGGGCTTATGTGTATTGGTACGATCATGAGGGTGGATGTTGTGCATAGAC
CTTTAGGGCATTTTTTGATGTGTGGGATTGTAAAGNTGCAGNAGATTGACGAAACACATTTGAATTATGAAGGATTTGAGTTTGTTTGATTGCATCAAAA
AAAAAA
page-top