Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20083  (registered. 2007)
Contig Information
Length 1357 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera]
Score 388
Evalue 2.31789e-35
Total Hit Count 84
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20083
CACAGTACATAGAGGCTACAACAGGCTACAGGAGATCATCGACTGATGATGGATAACTACAAATAGACAGACATTCATCATGAGAATGAAATTACATTTC
TCAAACAGATGTTCTCGGGACAGACAGAGGCGGGATTTCTACAGGCAAGTGAATCATCGTCAAAAAAAACGAAGAGCTACCACTGCACAAATTTCAAAAG
CAGGTTCGGCCTTCGCTCTCCATCAGAAACCCGGATCATCTTTACATGATGCCCTGGGCAGTAGAAGAGTCATTTCCATTTTCACAAGAATCCTTTCCAA
ACACCTCTTCTATCACATTGTTTGTCGAAAGAAATTCGTCTTTCTCCCAAACGCTACTGAAACCAATATCCCATGTTTTCGGGTCGCAATGGCCACCAAA
GTATCCATGATCTGCAACGCTACCAAAGCCAACATCCCGGTAGTGGTCTCCAGCAATATCAGTGGGTGTGCCATCCGTGGTACAAACATGCGGAGCCTCA
AATGATGTGCACGAGTCGTCTTGAGCATCTGCGTCAAAAATGGTTGCCCCCTGGTTAACGTCCACAAGGGACACCATGACATTCCCCTCCATGCAGCAAT
TTTCTTGCCTGTCACCACTAGAACAGTCAAACTCATCCTCCTCACCAGACTCTTCATGCATATTTCCTTGGAGGGGAACTTGATTGCATGCACCATCATC
TTGATCAGTAAGAGACTCGAGCAGCAAATCCTCACCAGCCCTTTCTGTCACAGCAAATTCATCATCATCTCTTCCCTCCCATTCATCATTATCACTGTCA
ACATTCATTGGATCAAACCTATTCTGCTCAGCCCCTCTTCCTCAACATGTAGACATTGAAATAGTAGCTCACTAACTCTTTGTTAGTCTTCAATGGGAAG
GCAAGCAGAAGTTCATCCCAGAAGTTCCTTCCAAGAGAGGCAAGGGTTTAATGATACCACATCCCTGGAACAAATGCTCTTCATCTTCAGTCCATTTCAA
GGCCACCTCCTCTCCCATGTCAAAGAATCCTAACTCTTTGAAGGTGTTCAGATCAAGGGCACTCATTAGTCTTTCTCTTGCTTCCTTCACATGCTTCCTC
ACGCACGCAATCGAACCTTCATCAACACAACTGCAATCTGTCTTACAGCAAACAGGTTTCAGCACTGAAGATAACTCAACAGAACCAGGCATTGGAATAA
CAGAGTTCCTAATCCACTTGTCACTCCCGGCTTCCTTTATATCACATATGTGAGAAGATGATGACACATCAGCATTACCATCAACTGAGCTCCTACAATT
ACCAGATGCACACTCTGGCAACTCAGCCTGATAATTTGGCCCAATTGGAACAGTTTT
page-top