Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11523  (registered. 2012)
Contig Information
Length 1198 bp
Clones alternative view 63 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 2
Wh_EM Dormant seed with water absorption 1
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 1
Wh_VWD Shoot grown with dessication 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 5
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 4
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 3
WH_XB Root 6
WH_XC Root, treated at 50 microM Al for 6h 4
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XE Seedling, infected with leaf rust 5
WH_XF Seedling, infected with leaf rust 6
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226491714|ref|NP_001149195.1|| vacuolar ATP synthase 16 kDa proteolipid subunit [Zea mays]
Score 317
Evalue 2.00E-84
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11523
GTTTCCTATCCCTATGATATTACTACCCTATGAATCAAAGGAATTCAAAGGATTTTAAATTTGTAAGGAACTTTGGTGGCATCAATAGAGAAACAATAGA
ATTTTGGATGGTTCCTCGGTAGGATAGTACAAAAACAAATCATTAAAAAATCCTATAGAATTTAATCCTACAAATCACTTTTGAACCAAAGGGGGCTGTT
CTGGTGTTCTAGTTTCAAACCATGTGTACTTCTCCTTTGCGAAAAGGATAATACACAAGAAAGGATATTGTGGGATGAATGGACAAAACTCAATTGCATT
GCAAGTTCTCGCTTATTCACCAGATTACACCGTCCAGCCAGACCCAAAAGGTAAATAACTGTGCACAAATAAGCATCAACCCCCACCCAGCATCCTGACG
GAAAAAGAATGGTACATCAAGGGCAAAGCTCCCCTGGCTACAGATGTTTTTTTCTCCACCAAACAGAAGAATGAAAACTAGACATGATAACCTCTAGAGC
TCAGTTTGCTGTCTGAATAATATAAAACAAGAGGGCACACAGGGCCGCGTGTGTGGAACATGCCTAATCGGCACGAGACTGGCCAGCTCGGGATGACAGG
ATGATGCCGACAATGAGACCGTAGAGAGCGAGCGCCTCTGCGAAGATGAGGATGAGGATCATGCCGACAAACAGCTTGGGCTGCTGAGCATTTGCCCTGA
CTCCAGCATCACCAACAATGCCGATGGCCATGCCAGCAGCAAGGCCGGCAAGGCCACAGGCGAGCCCGGACGAGAGGTGGGCGTAGCCGTCGAAGAGGTA
GTAGGGCTTGGCCTTGGGGTTGATCCCGGTACTGATGATGACGGCGATGATAAGCCCGTAGATACCGAGCACTCCAGCCATGACAACGGGCACGATGGAC
TTCATGACGAGCTCCGGGCGCATGACTCCCATGGACGCCACGCCGACGCCGCTCTTGGCCGTCCCGTAGGCCGCCCCCATACATGAGAAGACGAGTGCCG
CGGCGGCGCCGAGAAAGCCGAAGAAGGGGGCGGTCTCATCGCCGCTGAACACCGACGACATCTTCCTCCTCCTGGTGCTACTGCTGGGATCGGGGTCTGC
TCGCTCGTCCACCCAAGCAAGAGCTCGAGCTCGAGCTTTTCTGTTGTCGCTTTGGGATTTGGTTTGGGCTTTCGTGCGATCTGATCTGAGGAGGAGGG
page-top