Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20051  (registered. 2007)
Contig Information
Length 1584 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 4
Wh_RDr Root of dessiccated seed 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_17662 [Oryza sativa Indica Group]
Score 636
Evalue 4.96044e-64
Total Hit Count 143
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20051
AAAGAGCATAAAGAGGAAGCTGTAAACTCCCCCAGCCAACTATCATTTGGCAACTTTATCAGAAGTGACAAATTGAACGGGGATCCTGTCATTACCGAAG
AGAAGTCTTCTAAGGGTACGTCTAAATCGGAATGGAAGGTAAAGCCCACAGGAATCAAGAGGCCAACTAGCATAGCTTCAAAGCTGGTATCATACAAAGA
TGTGGCAGTGTCACCGCCTGGCACAGTGTGGAAACCAATTTTGGAACAGAAGGAAACAAAGGAGAAGGATAACGAACAAGATACTGATGTAGCACCTTCA
TCCGAGGAAGGAGATAGAAAGCTTATAGATGAAGAGAAGGAGAAGTCAAGTGATGAGAGCAGCAAAGAGAATGTCTCAACTCAGCCAGAGGGAAGCAGTC
CCCCAGAGCCAGAGAAAGCTTCTGACAGCAATAGTGACGGAAGCTCATCTCCGGGCAAGAAAACAAGTGGAAGCAAACTTTCAGCCTCAGCACCTCCATT
CAAACCTGGATCACTCTTATCAGTGTCCCATCCTTACAGCACAGTGGCAATATATGATGCCAGCGTTGTGCTTCAGCCAATCCCAAGTCAAGCAATGGAG
ATTCTCCCTCATGCTGTCGATACTAGAGTACCCCGTGGTCCTCGGTCCACCTTGTACTATCGTACTGGACATTCTTTCCAAAGGAAACAGGGTTATACAC
AGAGGCCAGAGCACTATTCTGAGGGGCAGCACCTCCCCTCCAACCATGAACCCCCATGCTGCTGAGTTTGTGCCTGGAAAAACTGTGCAACAAACTGATT
TGGCTGCAGGGGAACAAACTAATTCTGTAAGTGATCCAGCAGATCAGCAGTTGGCATCACATGCCTCAGATGGAGTGAAAGTCGATGTTCGTGAGGCAGA
CAAGGCAGGTCAAGTGGAGAAGACAACTCCAGGTAAAGTGAAGGAACGAGCGAAAGAGGCGACAAGAGATTCATACAAAGCAGAACTTGCAAGGCAGATT
CTGCTCAGCTTCATTGTCAAGTCGGTCCATGACAGCTTAGGTTCGACTCGACCTCAACCGGACAGAAAACCAAGCGGGTCAGATGAAGCTAGTAACGAAC
AGAGCAGCAACGTAACCAAGACTGCCGTAAGTCCGAAAGAGTTCGACAAACAACCGAAGGCCGCCGAGGTGCCCAAGAGCGAGAAGGATACAGAGGGGTT
TACAGTGGTCTCAAAGCGTAGGAAAAGCAAGCAGCACTTCGTGAACCCCATAAACGGTCTCTACTCTCAGCAGTCAATCTGCACTTCGGTCAGCTGAGAG
GTTGCTGCGCTCCCTGAGACCTGCAAGCAGTGCAATGTGTTGGAAGATGGTATTGCTTACTTTGCTCTTATTAGGCGCTTGGTAGCAGAGTTTTGCCCTA
TATTCAGATGAACGAGCATGTTGTCAAACTGTACAAAGTTTTCCGCCGCCCCTTTGCCAATAATTTTTTTGTAATTTGAGGTAGCAGAATAAAATGGTTT
CCCCTCCTTCCTATGGATGTACTATGTTATTATGACAGAATTATAGGATATAGTAGCAAACATTCATTTCTTCCAAAAAAAAAA
page-top