Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20013  (registered. 2007)
Contig Information
Length 1049 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_SHDr Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08334 [Oryza sativa Indica Group]
Score 886
Evalue 9.04042e-105
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20013
ATGCTATATGATGATTTCGTCATGGAAAATGCAACAGCACACACACGACCAATTCACCCAACCAAGTCTGAAATATCAAGGTCTCGGCTCCAAAATAATA
CTGCTGGTACACGACAGAGTAGGCAATAGGCCAACAAAAGGATGAATGATACTTTATGGCTAACTACCTCATAATCTTAAGACGCCAAGAATAATAATAC
CGCGCATCAGATCAGCTACTTTAATCAAACGAGAAAGGAACAATAGAATGCAGTCGATTACTGCGGACTGTGCGCCCTTAACACCGTTGCCGGCGCCTCC
TTACTGCTGGGCGCACTGCACACCCCTTGGTGCACCGCCTTCGTCATCGTCTTCCTCGTCATATGCTTCTTGCCGCCTCTGATGCTGCCTGCGCCTCATC
TCCTCTTCGATGTTCACGTCGTGCATGGTGGTCTCCTCGCACTGGTCCACGTCCATGTCCGACGACTGGCTCCCTGGCCTAGGCGGCAGGATCTTCTCAA
GTGACTTGCATTGGCTAGGGGTCAGTACTCCGGGCTCAGGGAACTCCACGCTGAACTCGACAAACAGGCGACCCTTCATGAAAGGCCGGCCGTGCTGGGG
CATGCCCTCATCATTTATGGCCTTGTGCTGGCCAGGCTTGATGATCTCCCCAGGATTGGATTTGATCAGAAGCTGCCGACCATCAAGATGGGTCAGAACA
AACTGAAAGCCACAGAGAGCCTCAGTCAGAGAGATCGTGTGCTCAACAAATAGGTCATCCGACTTCCTCTTGAATTTTGGGTGCTCTTTAAGTTGCAAGA
CAAAAACAATGTCTCCTGTCACTGTATCAGGAGCTTCATCAGCTTCACCCTGGAATACAATCTTTTGGCCATGTTGCATTCCCTTCTCCACATGAACCTC
CAAGACCTTCTTCTCCTGGGATACTTTGTTCCCTCTGCAGCTTGGGGCATCTATCCTTGGTCATTTATCATCTCGCCTGATCCTCTGCATTCAGGGCAAA
CAGTATTCATCTGTTGGATCATGCCAGGTCCGATCTGTCTTGTTATCAT
page-top