Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19991  (registered. 2007)
Contig Information
Length 1094 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_34843 [Oryza sativa Indica Group]
Score 773
Evalue 3.86357e-80
Total Hit Count 232
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19991
TTTTTTTTTTGACTGAAACTCGATTTAGTATCTACAGTTGTTCAAATGTCATTACAAATTAAACACTGACGAAGTAATAAGTACAACACGGCTTCAAGTT
GACATAATAAACTGTTTGTCATGCCGCTCCCTTTATAATACAAAGCATCCACAGAATGCAGGAGCAGCAGTACAAGGCAAAAGCCAGACGAATTTTTGGA
CACCTATGTACAACAAGGAAGAACTAGTGCATAATGTTTCGTCTGGGTTTACGCAGCCTGGTGTGGTCTTTCTACCTTCATGCATCACGCAACAAACCCT
CCTCGGAGAATGGCCCGACCATTGTCTTTTTGCCAGCATCGCACGCTTGGACAATGGTACATATATCGTTCTTCTCGAGGAACTTCTCTCCGTTCACCAG
GATGAGAGGGATGTATTGCAGGACCAGTCGTTTGCACTGCTGTTCATGACCTTCGATCTTCTTGCACTCCTTGAGGAGAATTTGAATTATCTCAAACTCA
GCATCAGGATCCTTCAGTTTGGACAAAACTTCATCCATGAGGTGGTGGCAAAACACGCATGTGCTCTCACTTCTCACACCAGACAGAAGAGCATTGTCCC
TGCAGAGGCCATTTCGTTTGCAGAACTCTTCTGGCTTGATCTCAGCGATCTTGGCAAATAAGAGAGTTGCATAGGAGTCCACAAACTCAACACACTTCTT
TTCCAACGAGAATGTCTGAGAACAAGCTTCATGAAGGACCTCCATCATCTTATCTTGTGATTGTTTCTGACTAAGATAGCTAAGAGCTTCCTCTGTAAAC
TTCTCACAAGCTGGGCATAGTGGGCTGCCCCTCTCAACACGCACGGGAATTTTGCTCAAAGTTAGTTGATCCTTGATGATTTGACCAGAGCCTCGAGCCT
CCTCCTGGATATCAAGAAAAACTGTGCTCCGGCCCTTGTGCGGCTCCCAGGCTGACCAGCAGCAAGAGGAGTAGGAAGAACGGCAATCTCAGTCCCAAGC
CCATCGCGCGATAGGTTCTGTCGTTGACCCTGCTGCGGTTGGGGAATCGAGTCGAGCAGGCAGCCGCCGGGAGGAGCAGGTGGTGGCGCGTCGG
page-top