Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19972  (registered. 2007)
Contig Information
Length 683 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_34241 [Oryza sativa Indica Group]
Score 306
Evalue 2.39831e-26
Total Hit Count 115
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19972
CACTCCCATCCCACCTCCACCACCGCGGTACGTACCGTTTGCGATCAAAAGAAAGTCGAGCCATATGGCGAAGGCCGCAGCGATGCTCGTGCTGGTGGCG
CTAGTGGTGGCGGCGATGGCAACGGGCGGAGCGGCGCAGTGCAACGCGGGGAGCCTGGCGGTGTGCGCCTCCCCGATCATCAGCGGGGCCAAGCCGTCGA
CGACGTGCTGCAACAACCTAAAGAGTCAGCGGGGGTGCTTCTGCCAGTACGCGCGCAACCCCGCGTACTCCAGCTACATCAACAGCCCCAACGCCCGCAA
GACCCTCACCAGCTGCGGCGTCGCCGTACCGAAGTGCTAGTAGCCGGGCCTCCACCGCCGCCGGCGTGCTAGGCAGCGCCACGCTGCCTATTGCTACTAG
TACTACGTAATGTACTACTACTACGTACGAGCTCCTACCATGGCTGCTGGTACGACGTCGGTCGAACAGCTCCGTCCGAACCGTGTGTTCATGTATCTTT
TTTTCTCTCCAATACAATCGTGTGTTCATGTATCGTATGCAAGAATAAAATGGTGTGTACGTGTTGATCCAGCCTCTGCGTAGTTTGTTACTCATTTCTC
AATTCTGATCGATAGATGTCGATCGATCTCGTGTAATTTCTGTACCTCCGACAATATATATCCGCATCTTAACAAAAAAAAAA
page-top