Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19913  (registered. 2007)
Contig Information
Length 1378 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 4
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit casein protein kinase 2 alpha subunit [Lolium perenne]
Score 1651
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19913
ACCAAACACGGTTACATGAAAAGTGTGTTGCGAAGTTTCAATCAATCTGGTTTCCATACACAAACAACAGGAGCAAATCACAGTTCTTTTCCGCCTCGTC
GATGAGGCACACACCACACAGGCTCTTACCTTTCCCAGCTGACCCAACCATTATCGAGTCATAATACATGACAAAGTCACTACAAGGATGCGGCTTCGTC
AAGTGCTGCTCGTTCAATATCAGCAACAGTCTTGCTATTGCTATTGCGCACGAGTCCTGCTGTTTTCGGCAGCCCTCACCTGGAGGAAGTATGGATGTGC
CATAGCTTCACGTGCAGTAAGCCTATCCTGGTGATCATAGCGCAGAAGCTTATCAAGGAAATCTATGGCCTCAGGGGATACTAGATGCTGGTTGTCTGCA
TTGATAAACTTTGACCAGGGTTTTCTGCTGTGCCTTCCAACAAGGGCTTCAAGCTGAGGGTCAAGCTCAATTCTGTACTTGTTCAAATAAGCATTTAGCC
CATCTGTTCCAAGTACCTTTGCAATTTTAACAAGTTGGTCATGGTTGTCATGGCCATAGAAAAATGGTTCCTTGCGGAATATCATTCCAGCAAACATGCA
GCCAAGACTCCACATGTCCAAAGAGTAGTCGTAATCTTGCAAGTCAACAAGAAGCTCAGGTCCCTTGAAGTACCTTGATGCAACACGAACGTTATACTCC
TTTCCAGGATGGTAGAATTCAGCAAGGCCCCAGTCTATTAACCGGAGTTTTCGAAGCTCATGATCTATCATAACATTGTGAGGCTTCACATCTCGGTGCA
TAATGCCTTGTGAATGGCAGTAATCCAAAGCCTTCAGTAACTCATAGATATAGTAGCGAATGTCATAATCTGTCAATGTCGGATATAGCACTTTGAAATC
TGTGTTATTGATGTATTCAAAGATCAAGCTTGGTGTTTTTGAATGCTGATCCCTGACAATATCAAGCAGCTTCACAATATTTGGACCTCCACAGAGATTC
TGTAGTATTTTGATCTCTCTTTTGATCTTCTTCTTCTTCACAGGCTTCAGGATCTTAATAACACATTTCTCATTATTGTTGACGTTGATACCTTCAAAGA
CTTCACTGTATTTGCCCCTTCCAACTTTCCGCACAACTTCATAGTCATCCTGCTCACCCCACTGGACGGCGAGGGCCTCATAATCCCAGTACTCCTTGGG
GCGCACCACGTTAACGTCGGCGTAGACCCTGGCCTTTGACATGGCTGAAGACGATCCGGATCCCGCGGGCGGGCGACGGATCAGAGAGATGGGAGGGCTC
GGAGGAGTTTGGTGCTTTCTCGGCGGCGCGTCCGTCAAGCGGACATCGCCGGCGGCGAGATGGCGCTAGGGTTCAACA
page-top