Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19910  (registered. 2007)
Contig Information
Length 944 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 4
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_022593 [Oryza sativa (japonica cultivar-group)]
Score 957
Evalue 1.40594e-101
Total Hit Count 225
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19910
TTTTTTTTTTCGTTCGTTTGAACCTTCCTTCTGTATAAAATAATCACAACGGATTGGCGATGAGCAAAATATGCAGAAGTGATCAGATATCTGATTCAGC
TACTTGCATCAGGCTCGCACGTTCCAAAAGAAAAAGAAAAATGTTTCTCCGAACATGATTAGATGTGCTCTGTGTCATCTGTATGTATGATAATCAGGCG
GCTGTGTTTTCAAAATGGTTTTCCCGCTGCGGCGCATCGAAGGACGAACATTCCTAGGCGGCGACGCCGACCGGCGCCGCCCCGACGGCGGCGAGGATCT
TGTCGTCGAGGTCGAAGGTCATGGCCTTCTCTCCCCGGCCGCTGCTCGCGTACTCGGCGAACCGCTCCTTGAGGTCCTCCGGCAGGTTGGTGGTGCTCGT
CCATCCCAGCACCTCCTTGGCCGCCCGAGGCTCCGCGTAGAAATGCATGTTGCGGAAGGGGAAGGCCTTCTTGGCGTCGACGCCGGCGGCGGCCGGGTCG
TAGTTGACGATCTCGACGGTGGCGCCCGCGGCCGCCGCGCACATCTTGGCCAGGCCGTTGAGCGTCACGCCGCGGTCGCTCACGCAGTTGAAGATCTTCC
CGGCGGCGGCGTCGGGGTTGTCGACGGCGAGCGTGAGCATGCTGCCCAGGTCCCTCGCGTGGGAGATGTTGGTCAGCTGCATCCCCGACCCCGGGATCGG
CACCGGCCGCTTCCGCACGATTCTGTCGAAGAACCACTCCTCGCAGTCCTTGTTGTTGCCGGAGCCGGTCATGTACTGCGGCCGGAACGACGCCCAGCTG
CCGAACTCAGCCGCGATGTACTTCTCCACGCCCACATGCCCGGCGCTCTCCTTCACGGCGTCCCCCTCCACGTGCGGCGGCTCGTCGGTTTGAAGGTAAA
TCCCGGCGCTGCTGATGAACAGGAACTGGCCGACGCCGGCCGAC
page-top