Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19845  (registered. 2007)
Contig Information
Length 938 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_RDr Root of dessiccated seed 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit prefoldin-like [Oryza sativa Japonica Group] >gi|50251815|dbj|BAD27746.1| prefoldin-like [Oryza sativa Japonica Group]
Score 385
Evalue 2.98398e-35
Total Hit Count 135
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19845
TTTTTTTTTTGCCAAAAATGAATCTATTAATCAACATAAGCAAAGATAGAAGAAATAAAGTGGTACATGAAAAAATTGATCCAATTCCTTCTCGAAACAA
AAGTCAATTCAACCATATCACTAGAAACCAGCAAGAGGTACATCTTCAACCGAGTATCCACTCTCAAACAAAATCTCTCACTACACAAACCTGGAACTTC
TCTCAATCTCTGAACACTACAGATTTCTTTCACCTTTTTAGGGGATAGATAACACAAGGCAACTAACTTCGCCTTGTACAGACCCATACATTTGGGAGGA
CGAAGGCCCTAATGCAGGGAGCCCTTCATTTACGCCTGCGCCTTTGCTTGTACAGCCTGCATCTTCTGTTGCAGCTTGATTATCGATTCCTTCTTGCTAT
TCTGTTTCTCCTCCAAGTCCTTAAGCGCCCGATCCATTCTCATTAGCTCAGCTGTGATGTACTCGATGCGCTTTTTGATGTTGGCCTTCGCCTCCGCATT
GTCCTGCTTGACCAACACTGGCCCGATCAGCTTGTACACGTTCGCCCCTTCATTCAGCAGCTCCAGCTCCTTGAGGACGAGTTCATTCTCGCCGACCTGG
ATGGTGAACTGCTTGCGGACCTCGTGATTCTTGGAGATGTCTTTCTGGATCTTGCTGAGGGCGTTGGCCTGGGACTCGAGGTCGCACTGCATATCGCGTA
CAGCAGCCGGTGCCGTTGCCAACGACGACGCCATGGCTGTCACAGCTTCCTCCGCCGCCTCGGCTTTAAGCGTGGGAGTGCAAATATAGATGCGGCGCCG
TCTACTCTGTTTCCGGGTTTGGGCTTCTGCAGCTTCGGAACAACCCAGAAAGACGAAAGTCGCTCCGGGCGGATCTCCGATCGGGGGAGAGCAAGCGGAG
CAGCAGTCCCGGCCGGTGGTTCAGGCGGAGATCGCGGT
page-top