Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19822  (registered. 2007)
Contig Information
Length 1005 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0275600 [Oryza sativa (japonica cultivar-group)] >gi|6539559|dbj|BAA88176.1| putative zwille protein [Oryza sativa Japonica Group] >gi|113532253|dbj|BAF04636.1| Os01g0275600 [Oryza sativa (japonica cultivar-group)]
Score 806
Evalue 5.07686e-84
Total Hit Count 307
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19822
GGGGAGGGGGAGAGACGAGTTCCGAAGGGGAACGGAAAAGAAAGCCAAGCCATCTCTCGCGGAGGCGAACGACAAGGCTTCCTCCCTTGCGCCCTCGCAG
ATCAGTTCAGCGGTTCTGCTCCTCCGGACCATTGTGGGTTTGCTGAAATGGAGTCGCAAGGTGATGACCTGCCACCACCACCACCACTCCCGCCAAATGC
AGAGCCGATAAAAGCTGAGTCGGCTGATGACTTGCCACTACCACCACCCCTGCCGCCTATCAAACCTGAAGAAGCAAAGAAGATTTCAAAGCCTAAGAGG
GCCCTGATTGCTCGTCCTGGTTTTGGCAAGAGGGGAAATCCTATACAGCTTGTGACAAATCATTTCAAAGTCTCGTTGAAGACGACAGATGAGTTCTTCC
ACCATTACTATGTAAATCTGAAGTATGAAGATGACAGGCCTGTTGATGGAAAAGGTGTTGGTAGAAAAGTCATTGATAAGCTTTCACAGACTTATGCATC
GGAGCTAGCCCATAAAGACTTTGCCTATGATGGTGAAAAGAGTCTTTTTACCATTGGTGCCCTCCCACAAATTAACAATGAGTTTGTTGTGGTTCTTGAA
GACGTTTCCAGTGGAAAGACTCCTGCAAATGGCAGCCCTGGAAACGACAGTCCAGGAAATGACAAGAAGAGAGTGAAAAGACCATATCAGACTAAAACCT
TCAAGGTAGAGTTGAGCTTTGCAGCAAGAATCCCCATGAGTGCTATTGCAATGGCACTCAAAGGCCAGGAATCAGAGCACACGCAAGAAGCCATTCGGGT
TATTGATATCATATTAAGACAACACTCTGCCCAAACAGGGCTGCCTGTTAGTCCGCCAGTCATTTTTTCACAACAATCCTTCAAACTTTGTGGATTTGGG
TGGGGGTGTGATGGGCTGCANANGTTTCCACTCNANCTTTCNANCCACNCNNANTGGGCTTTCTCTTANTATTGATGTTTCTACNNCNATGATTGTNAAA
CCTGG
page-top