Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19786  (registered. 2007)
Contig Information
Length 1474 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_OKCS Seed DPA5 1
Wh_VSCB Liquid cultured tissue 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit CAA303719.1 protein [Oryza sativa] >gi|90399022|emb|CAJ86142.1| H0701F11.8 [Oryza sativa (indica cultivar-group)] >gi|116311976|emb|CAJ86334.1| H0814G11.1 [Oryza sativa (indica cultivar-group)]
Score 1380
Evalue 1.6233e-163
Total Hit Count 293
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19786
GCCTTTCTCGCGCGCCCACCCACCCCCGGACACACCCGCCTCACTCCCAACCGGACCCAACCACCACTCAAGGTCGGCACTGCCGTTGCGATTTCTTGGC
GAGCGTTCAGATCAGATTTCGCTGTGAAGAAGCCGCCGGATCTTCTCCGAGGGCTGGCCGAGATCCGGAGTGCAAATCTGAACCCCGTGCGTCTCCGAGT
CTCGGGGGATTCCATGCGAGATTTTGATTTTGGGGATCTTTCTTGTTGGATAACAGTTCAGCGGCCGTCCGATCTGCGCTCTCTACACCAGTGATTGCAC
TTTTTGCTGTTGTACCCTGCTGCGGTTGGTTACTCAGGGTTTGCATCAAGTCCAAAGATGACTTTGCGCAGCATAGTTCGCGATTTAAGGGAGAGCTTTG
GAAACCTGTCAAGGCGGAATTTCGAGGCGAAAATCTCAAGCGTCCCAAGCCTTTCGGGCCATCACCGAGGGAAATCGCTTGAATCTGCAAGTGATCTGCA
GGATAGTCTTGTCACAAACCTGCAAGGCAATTGGGCTAGCCTTCCTCCTGAATTACTTCGGGATGTGATGAAAAGGCTGGAGGAAGACGACAGCAATTGG
CCGTCCCGCAAAGATGTTGTTGCCTGCGCTTCTGTCTGTACAACCTGGAGAGACATGTGCAAGGATATTGTGAGGAATCCAGAATTCTGTGGAAAGCTCA
CCTTTCCTGTGTCCCTTAAGCAGCCTGGATCTCGAGATGGATTGATCCAATGTTTCATCAAAAGGGACAAGTCAAAGCTAACTTATCGTCTCTACCTGTC
CCTTACTTCTGCTGTGCTTGATGATAATGGCAAGTTCCTACTGTCAGCTAAAAGGAGTCGGAGAACAACTTACACCGACTATGCCATTTCTATGGATCCT
AAAAATATATCCCGGTCAAGTAGTGGCTACATCGGGAAATTGAGGTCAAATTTCCTCGGCACCAAATTCATCATCTACGACACGCAGCCGCCCTACAATG
CCAGTAAACTCTGCCCGCAGGAACGGACCAGCCGGCGGTTCTCCTCCAGGAAAGTTTCCCCGAAAGTTCCTGCGGCGACCGGTAGCTACCCCATCGCTCA
GGTGAACTACGAGCTGAACGTGCTCGGCACCCGCGGGCCAAGGCGGATGCAGTGCACCATGAACTCCATCCCGACATCAGCGGTAGACCCCGACGGCGTT
GTGCCTGGCCAACCGAAGGAGCTCCTCCCCCGGCTATTCGAGGAATCCTTCCGCACCACAGCAAGTTCCAGGTACTCCACGGACTTCAGCAGCTGCCGCT
TCTCCGAGTTTGGGGGAGGGCCTCTGAGAGAAGAAGGCGGCGATGAAAATGCGGGGGACAAGGAGAGCCCGCTGGTTCTCAAGAACAAATCCGCCTCGGT
GGCATGAGCAGCTGCAGTGCTGGTGCCTCAACTTCCGTGGCCGCGTCACGGTGGCCTCGGTCAAGAACTTCCAG
page-top