Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19785  (registered. 2007)
Contig Information
Length 822 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit homeobox-like resistance [Triticum aestivum] >gi|167882868|gb|ACA06113.1| homeobox-like resistance protein [Triticum aestivum]
Score 863
Evalue 8.81652e-91
Total Hit Count 41
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19785
CAGAAAACAACATTCGTCTCACGATATAGCTATATAGATACCGACAATCCAAGACTTTGTACACACATCAGCAAACAAGTCGACATCGGCACATTACAGT
TACCGGGCGACCATCCTTCCTCGACCGGAAGTTCCTAAGCAAACATTTTTTTGGACTTAGTAAGTACACACCGAAGCGCACAGGGAAGCGAAACAACTAC
GCTCCCACGTTCATGTTGTCATCATGTGCTTCATTTGCAGCTTCAACTTTTGGAATAACCTCCACATTCCCCATCTGCACATCTGAAACTGAATCACCGT
GGGTGCCAGCAGGCGCAGCTGGTAAGGGAGCAGCCGGCTTGTCAGATGGCCCTCCTTGATCTGGGTTGCGAACCACGGTCACCTCGGCAGTGTTCACATC
CATCATCTTGTGCGCCTTTTGGGGTTTCTGCTCAACTGGGCTAACATTCTGAGCATCCGCAGAGGCCGCCGCTCTAGATGCGTGCAAGATCTGGAGCCTG
AAATCAGTTTCTGGTCGACGGCATACCTTCCTCAGAGGAACAATCTCCTCAGAGTGATCATGATCATAACGAACAAGAAACCTGCAGCGGCACCCTCTTA
CATCATGCCTGCGCCTTTGAGCATCAAGAACACGAGCGTCAAAATAGAGGGCCTGCTCTTTGCCTTCCTGAAAACAAAGAATGAGATCCCCAGGAAGCAC
AGCAACACATTCTGCAGATTCACATGGAAGAGAACGCAGCCTCACACATTTACGAACATTAATCCATTCATCCTCCTCAGGCCCAAATCCAGAAAATCGA
ACTTTTACTTCCGGGTCCCCTG
page-top