Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19781  (registered. 2007)
Contig Information
Length 1179 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0464500 [Oryza sativa (japonica cultivar-group)] >gi|113564589|dbj|BAF14932.1| Os04g0464500 [Oryza sativa (japonica cultivar-group)]
Score 1087
Evalue 1.67812e-116
Total Hit Count 350
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19781
CTTACTTTGATAGACATTCATAATTGGTAGCAAGACGAATATAGACTCCACTGACGTTTATCGACAAAACAACCAGTACATCACAGGTTGCATGCAAAGT
GCAGTATCTAGTGGACATGATAAACCATTCAGCAGCACTAATTTAATAATTGCATCGGAAAGACATTCTGTGCGACAGATCCAGCTCGGTGAGAACTACA
TCTTCTGCATGATAACGGAGTTCTTGAGTCCAGCTTGGTCAACAGTCTGCGTAGGGTCAGTCAGCTGCTTGGGTGGGAAGCCAGTCTGCAACTGATACGG
CCGCGCAGCTCCTGGGCGGGATGCATCAATGAAAGACCTGATGTCGCCCACGGTGTGGTTAAGGTTAAACCGAGCGACCATGCGAGTGCCGTCCGCTAAC
CTTAGCTGTATGGATGTAAAGGGCTGCGAGTCGTCCACAACTATGCCAATTGACCTGGGAGCACCGTGGGGCTCTTGTGTCACAGGAGCTGGTGCAGGAC
TCTCATCTGCTGAAGACCCACCAAGGGTTCTACCAACACCCTGGAAAGCTGATCGAGGCCTTGCAGGTTCCTCATAATCTCCATGTCGTTTTATAACATT
GACATGGACAGCTGTCCTTCGATCAGCAGGCTCCAGCTCTTGGGGGCACTGGGACTTCTTGATGCTCTCAATGAAGTCTGCATTTGCAGCGTCCTCATAG
GCTCTTAGTGGACCATCATCTACTGTGAAACCATTGTTCCAGAAATGTATATTGTGAAGAACATCCTGCGGTGGTTGAGGAGCAGCTGGTGCTGTCTGCG
CATCCCCTGAAAGCAGACGACCTGTTCCTGCAAAGCTGGTTGAGCTGGAAGATTGGCCTTCAAAAGAAGGCAGTGGAACTTGCTGAGCACCCATCACTCT
AGCTTGCTCAAAGATTGAGTCCACATTATTTCTCCTTGTTGGATCTTGAACAAGCATCCCACTCTTCTCGCCGCCGGTGTAGTACTCCTGGGGCTCATCG
GAGTCGCTGCCGCTGCCGCCTGCGCCTGGGAACCCGGAGGGGCCGCGGTTGATGTCGGCGAGGGTGCGGATGCCCCCGCGCCCGCCGGACGGTGCCGGCT
TCTTCCCGCCGTTGCCGTTGGAGGAGCTCATCGCCGACGTGTTCGCGGTAGGGTTTGGCTCGCGGTCGCGTCGTGTACT
page-top