Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19755  (registered. 2007)
Contig Information
Length 943 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_14427 [Oryza sativa Indica Group]
Score 979
Evalue 9.08086e-106
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19755
TTTTTTTTTTGCACATCCTCAACTTTACTAATTTATTACTTCTTCTCAAACTCAGCTAGCCAAAATAGTTTTCAACATGGCAATCGCCACGAAGCGTGCC
AAACAGACAATAGAACAGGCCATCATTATCCATTACACACCATGATTTCCTCCTTAAGGTGCCACGGTTCTCTCCCCTGGCAAAACGATCACCACACGCC
CCTAAAATTGCATGCCCCCAGGTTGCTACATATCATTGCGCTTCTACATCATGCCCTGGGGCATCCCGGCGGGCGCGGGAGCCTTCTTGCTCGGCTTCTC
CACGACGATCGCCTGGGTGGTCAGGACCATTCCGGCCACCGACGCTGCGTTCTGCAGGGCGCACCTCGTCACCTTCGCTGGGTCAATGACGCCAGCCTCA
ACCAGGTTCTCGTGCTTGTCGGTCATCGCGTTGTAGCCGAATTCCCACTCGCTGTCCTTGATTTTCTCCACGATCACCTCCCCTTCGACTCCGGCATTGT
GCGCGATCAACGATGCGGGTGCCACTAGAGCCTTCTGAATGATATCAGCACCAAGGCGCTCCTCAGGGTCATCCAGCTTCTCCTTGATAGCTGGTACGAG
AGTCGACAGGTGAACATAGGCCGCACCACCTCCAGGTACTATACCTTCCTCAATGGCTGCAAAAGTGGCATTCTTGGCATCCTCTATGCGGAGCTTGCGG
TCCTCAAGCTCCGTTTCTGTTGCAGCTCCAACCTTGATCACAGCAACTCCGCCAGAGAGCTTTGCTATTCTCTCCGCCAGCTTCTCAGAATCATATGTCG
AGTCTGTCTGAGAAAGCTCTCTCTTCAGCTGCGCAATTCTAGCCTGGATCTCATCCTTGGTGGCAACATCTGCTATTATGGTTGTGGATGACCCGGAANA
TTGTCACCTTCCTGGCTATGCCGAGCTGCTCCACTGTTGTCTG
page-top