Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19741  (registered. 2007)
Contig Information
Length 1756 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 2
Wh_OKCS Seed DPA5 1
Wh_VHS Shoot with heat shock treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0125800 [Oryza sativa (japonica cultivar-group)] >gi|12328528|dbj|BAB21186.1| putative WD40-repeat protein [Oryza sativa Japonica Group] >gi|14090382|dbj|BAB55540.1| putative 66 kDa stress protein [Oryza sativa Japonica Group] >gi|113531424|dbj|BAF03807.1| Os01g0125800 [Oryza sativa (japonica cultivar-group)] >gi|218187430|gb|EEC69857.1| hypothetical protein OsI_00212 [Oryza sativa Indica Group]
Score 2246
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19741
GTTGGTGAATTTGATGGGCACTCAAAGAGAGTTTTGAGTTGCGATTTCAAGCCAACCCGACCATTCCGCATTGTCACATGTGGTGAAGATTTTCTGGCAA
ACTACTATGAAGGACCACCATTCAAATTCAAACATTCCATAAGGGATCACACTAACTTTGTTAACTGTATCCGGTATTCACCTGATGGAACCAAGTTTAT
CACTGTGAGTTCAGATAAGAAGGGTTTAATATATGATGGCAAAACTGGAGATAAGATTGGAGAGCTATCCAGTGAAGGCAGTCACACTGGGAGCATATAT
GCTGTTAGCTGGAGTCCTGACAGTAAACAAGTTCTAACAGTTTCTGCTGATAAAACTGCGAAAGTATGGGATATCAGTGAGGATGGAAGTGGAACGTTGA
ACAGAACTTTGGTTTGTACTGGTATTGGTGGTGTCGATGACATGCTTGTGGGTTGCCTCTGGCAGAATGATAATCTTGTCACAATCTCTCTTGGTGGGAC
ATTTAATGTCTTCTCCGCAAGCAATCCAGACAAAGAGCCAGTATCATTTGCAGGACATTTGAAGACTGCTAGTGCCCTGGCACTTTTTCCTCAAAGTAAC
CCAAGAACTATGCTATCTACAAGCTATGACGGGGTTATCTTAAAATGGATACAGGGTGTTGGATATGGTGGCAGGTTGATTCGTAAGAACAACACCCAGA
TCAAATGCTTTGTTGCCACAGAAGAGGAGCTGATCACTTCAGGGTATGATAACAAGGTCTTCAGAATTCCTGTTAATGGAGATCAGTGTGGAGACGCCGA
GTCAGCTGATGTAGGGGGCCAGCCAAATGCTTTAAACATTGCACTTCAGCAACCTGAATTTGCACTGGTTACCACAGATTCTGCGATCGTATTGCTAAAC
AAGTCAAACGTCACTTCCACAACAAAAGTTAGTTACACTATCACTTCATCTGCTGTTTCTCCTGATGGCACTGAAGCTATCATTGGTGCTCAAGACGGGA
AACTGCGGATCTATTCCATCAGTGGTGATACTGTTACAGAAGAAGCGGTACTTGAAAAACACCGGGGTCCTATTACTACCATACATTATTCGCCGGATGT
TTCCATGTTTTGTTCTGCTGATTCCAACAGGGAAGCTGTTGCATGGGATCGGGCAACTAGAGAGGTGAAGCTGAAGAACATGCTGTTCCACACAGCTCGG
ATAAACTGCCTGGCCTGGTCACCCGACAGCCGTTTCGTGGCCACGGGGTCGCTGGACACCTGCGCGATCATATACGACGTAGACAAGCCAGCGGCCAGCC
GCATCACCATCAAGGGAGCCCACCTCGGCGGAGTCCACGGGATCTCCTTCTCCGACAACGACACTTTGGTGACCGCCGGCGAGGACGCGTGCGTCCGTGT
CTGGAAACTGGCGCAGCAGTAGGCGCTCAGGCTCATCCCCATTCATCAGTTAGCATGGCCGCCTATCGAAATAAACATCGCTATGGTCGGTCGCTGTTTT
CCCGCAGGCCGCGGTGGCGGCGCTTTCTAGCCTGTGTTTTTTTTTTCTTTTGTCTGTGATGTGATTCGTTCGTGTGCTCCAGGAAGAACCCTACTACCAT
TGTTTCCTTCCCACGCATCGTCTGGTCTTGTGAGGTGCCGAGAATACAGGGGGTGATGGTGTGTTGTGATATTTTGTCTGTGTGCTCCCTGGAGTGGTTA
TATTTTTTCTGTGTTTGCTACCCTGCAGCTGGTTGTTAATAACTGAGATCAATTTT
page-top