Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19717  (registered. 2007)
Contig Information
Length 907 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 3
Wh_DPA20 Seed DPA20 1
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_17477 [Oryza sativa Indica Group]
Score 881
Evalue 8.61387e-93
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19717
TATCTGCCATCATCACCAATATTAAGAATGTCAATGTAGTAAAATTACAGTGTTTTCATCACACATACTACACCACCAACTCTGCCCTACAAAGATGGTC
ACGTAGGCCGTAGCTCATAACGCCTTACCAAACACAAACCCCCGCATCACGCTGACAGTATACATACCAGACGCCCACAATCTTTTATTACCCAGCAGTA
ATTTTATTCAGCAAACCACAGGGTCACACGACCACACGCCTCATGCCACGAGGAAGAGCAAGGATAGATTGCTCCCACGCTGCCTTCTCCGAGCAATCAC
TGGAATGAACGGCCGGCGAACCTGCCGCGACAATAGGTAGGTAGTTTAGGAGGCGACTGTTTACAGCCGGGAGATGAGCAGCGGGACGGAGACGGTGGCC
GTTTGCTCGGCCATCGGGTGGCACATCTCCAGCATGTCCAGCTCCCTGAACTTCTCCAGGACCCTCATCCGGCACTCCTCCGCCGCCATCTCCCCTGTGG
AGAAGGCGCCGTGCACCGTGCCCGTGTACTGGACGCTCGTGGCCTCCCCGGCAAAGAATAGGTTGTCGACAGGGATGCGGAGCTTCTCGTAGAGGTCGCG
CGGCTTGCCCACCCCGTCAAAGGTGTAGGAGCCAAGCGTATTCTCGTCTGAGCCCCAGTGTGACACTAGGTAGTTAAGCGGCTCAGCTGCATTAGGGAGG
ATCTTCTTCAACTGGGAAAAGGCAAATTGAGCAGCGGCCTCATCCGACATCTTTTCAATGTCACAAGCAAGCCGGCCTGCAGGCATGTAAACAAGAACGG
CATGCCCTGTTGCCTTGTGAAGGTTGAGGAAATAGCTGCAGCCATATGTGGTGGATGAAACTACTCCGAGGAACTCCACGTTAGGCCAGAAAAACCTTCA
CTGAAGT
page-top