Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19716  (registered. 2007)
Contig Information
Length 1648 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit OSJNBa0065O17.11 [Oryza sativa (japonica cultivar-group)] >gi|116311120|emb|CAH68046.1| B0103C08-B0602B01.3 [Oryza sativa (indica cultivar-group)]
Score 2053
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19716
GCCTCTCTGCCCCGGGTGCTGCTGCTGCTGCTCCCCTCCCACCCGCCGCGCGCCGCCGACGCCTCCGCCGATGGACCGGGAACAAGGTAAGGCAGCGGCG
AGCCTGCCGGATTTGGGAGCGACTGTGGCTAATTCTGGGGACGATTCCCGTTGGTGTGCAGTGACGGAGTTCCTGGGCCAGGTGCCGCTCCTGCAGTGCC
TCCCCGGCTCCTCCATCCGCAGGATCGCCGAGGCCGTCCAGGTCAAGCACTACGAACCTGGTGATTATGTTGCCCGTGAAGGTGAACCCGTAGATGGCCT
TTGCATCATATTGGATGGGCAGGCTGAAGTTTCTGCTCCTGCAAACACAGAAGAAGCAAACCGTCCAGACTATGTCTTAAATAAGTATGACTACTTTGGT
TACGGGACCAATAGTTCTGTACATCAAGTAAATGTTATTGCGGTGACAAAGCTGTCCTGCTTTGTATTGCCAAGTCAATATGGACATCTGCTGCAAACCA
AGACAATTTGGAATGCAGAAGAAACACCTGAAAGCCATTCATTGATGGAACAAATTTTACATTTAGAGAAATTAGAGGTTGATATCTTTCGTGGATTTAC
TTTGCCAGAAGCTCCAACTTTTAATCAAGTTTTTGGAGGACAATTGATTGCGCAGGCACTAGCAGCAGCATCCAAGACTGTCGATTGCCTGAAACTTGTG
CATAGTCTGCATGCAATTTTTCTAATAGCAGGAGACAATAATATGCCAATAATATATCAAGTACATCGGGAGCGTGATGGAACCAGCTTTGCCACCAGAA
AAGTGGAGGCAAAGCAGAAAGGCCTTGTTATGTTCACTTTAATTGTTTCTTTCCAGAAGGAAGAATTAGGGTTTGAGCATCAGGCTGCAATCATGCCTGA
CGTTCCTCCTCCAGAACAGCTCCTGAATATGGAGGAGATACGGGAAAGAAGACTCACTGATCCACGGTTTCCGATGCAATATAGGAACTCAGCTGCCAAG
AAAAAGTTTGTACCTTGGCCCATTGAAATGAGGTTCTGCCAAGATTCTAAATCTCAACATGAACCAAGCCTGCATTATTGGTTTAGAGCTAGAGGAAAAC
TTTCGGATGATCCAGCTCTGCATAGATGTGTTGTAGCATATGCTTCGGATCTACTATATTCAGGCGTCAGCCTAAATCCGCACCGGAAGAGGGGTTTGAA
GACATACTCTCTCAGTCTTGATCACTCGATGTGGTTCCACAAGCCTGTGAAAGCTGATGACTGGTTGTTATATGTGATCGACAGCCCATCCGCACACGGT
GGTAGGGGATTCGTCACCGGACGTATGTTCAACCGGCAAGGAGAGCTCATCGTGTCGCTGACCCAAGAGGCGTTGATTAGGAGGGCCAAGACACCTGGGC
AAACCCCAAGGCCTAAGCTTTGAGATGTGCAGAAGAGCCGTGCCCGTACTTTAATATTTTCTTTTATCTTATAGTACACCGAGACAGCTGTGAGATTTAT
GTATAGGAGTACAGCTTACGGCTTGAATTTGGCACACATGCTTAGTGTGAATGATTGTATCCTTGCATGCTGATTCACATTCAGGTTTTCCTCTTAATAT
GTGGATTGCAATTGCCATCCAACATGCGGCACATGAATGTAGACAAAT
page-top