Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11486  (registered. 2012)
Contig Information
Length 621 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|238007554|gb|ACR34812.1|| unknown [Zea mays]
Score 219
Evalue 1.00E-55
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11486
TACATTGCTGAACATATCTTTGATGCAAGATTGAAGACAGCTTGAGTTTATCAGACCTCAGGTGTAAGAAACCTGTGGTTTATAGGCCAAGCTACACCTT
AAATGATAACTAAGATTACACAATCTATATCTTGATTTTATACAGCCTACATCTATATCGATGAAGCTCTTGCTGCTTTTTGATGTTTCACTCGGTGCAC
AGCTCTTTCATTCTTCTCTTTTTTCATTCTTGTCAGCTGCTGGTGGGGATATATCTTTCTCATAGATGACCTGAGCAACCAGGCCAATGAAAATTAAACC
CAGAGCAGCAACCTTCCTCCATTCCGCCTCTGGCGTTGCAAAGACGGCATTTGCGATTGTAAGACTGAGTATCGCCATCAGTGCAAGGTAAATATTCACC
CGAGCTTTTGACCCTGCACTCTCCTTTGTTATCTCTGTGACCTTCTGTGCTTCGATCCTAGCCTTCACCTTGATTTCCTCATTGTTTTGAGGTTTTTGGA
CCTTCCCAAGGCTTTTGAAGAACATGCCTTCGTTTTTCTCCTCTTCAATCCAATCTTCGAAGTCTTCTAACACCCTCTCGTTCATTTCTATCTCCTGCCT
TTGCATTTCAGCTGTCTCCTC
page-top