Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19650  (registered. 2007)
Contig Information
Length 1344 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_034384 [Oryza sativa (japonica cultivar-group)]
Score 1436
Evalue 6.87038e-157
Total Hit Count 83
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19650
CCTCACCTCCACGCATACAAGCATACACTAAAAGCTGCTTGGTCCAAACAAAATATGCAAATATCATTTCTCATATTACCGACAGTAATGTCAATTCTCA
AGCCTACCTAAGTGTGCCTAATTTGGCTCAGAAAATTGCGAGAAATTGAGATGTCAATTATTATCAGAAATCAACAAAACATACAAAATGGCAAACGGCG
CGAAGCTCTCAACCACCCCACTTCGATGCCTTGGCCGGTAAACTGGCCTCTGATTCCCAATGATGGCTTTCCTCACTGCTCACACCTGGTATGACTCTCA
GTACGGTAGGAGTGGAACTGAAGCAAAATTGTTCCAGCACCGCAAGCAAATCCACTAATTTCAACCTGATGCAACTTTCTTGCGGATTACTCTCTTTCGC
CGGGGCTTGGACAGCTGTGCCTCAGGCCCACCCTGCTTGATGCCAAGAAGACCAAGGCCTGACACAACTGCATCCTTGGATATAAACCACCTTGACTCTT
GTTGATCCGCAGCAGTAGTAACCTCCACTGGTCTGGTGTATGCCCTAAGTAATCGATCAGAGTACTGTGGATCAGCTTCCTCTCCAAGCCATGCGCGCCT
TGACGATTCACCTATCTGAATATTCATGAATCTTAGTGTTGTACCAATGAAGATTGCCATGCCAAGAACATCAAAGCGCTTGATCATATATTGATCTAGT
CCACACAATAATTGATATCGCAAGTTTGCATATAATCCTAGAAAAGCTCCATAACCAAGGGCATTGGCGCTAACATTAGGAAGGGTCACCGATAACCTGC
CATCCTTCCTTGCGGATAGGGCTTTCGACATACCACCCTGAATAGATCCAGCAACTACCCCGACCAGGCTAAGCTCAGCAGCCTTGTAAAGGAATGCACT
AATTCGTTTCTGCAGATCAAACTCTCTCAAAGGATAACTCTTCTCAAATATGTTGTTAGGAAGTTTCTCAATGGCATTTTGGAAGTCAAATCGGGATGTA
CTCCCATATGAACGGCATGGTGCCAGAAGCCCCAGAACCACAAGGTTGCAACACGATGCAGTCAAAGCATTGACAACGGCCAAATCCCATTCTTGCTCAA
ACCTCTCCTTACGAATATTCATCTCCCACCAAACAGATGAGGCAAAAGTAGCCAAGAACTCGAAAGCCATCTTATGTGGGAATGAAGGATCTGCAAGTGT
TCTTCCAACAAGACCTCGGGATAGCCATCCAGGTAGAGCTCGTGAAAAAGACCTAGTGTGTGTAGGTCTTGAAAACACTGACAAGAATCGCACCATCTGA
GCAGAACTTACCAAACCCATCTCATAAGCCTGACGGAGACCAGC
page-top