Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19638  (registered. 2007)
Contig Information
Length 1820 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_RDr Root of dessiccated seed 1
Wh_VHS Shoot with heat shock treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0114800 [Oryza sativa (japonica cultivar-group)] >gi|27476097|gb|AAO17028.1| Putative transporter [Oryza sativa (japonica cultivar-group)] >gi|108705841|gb|ABF93636.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113547217|dbj|BAF10660.1| Os03g0114800 [Oryza sativa (japonica cultivar-group)] >gi|125584682|gb|EAZ25346.1| hypothetical protein OsJ_008829 [Oryza sativa (japonica cultivar-group)] >gi|215694509|dbj|BAG89502.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1166
Evalue 0
Total Hit Count 134
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19638
GCGCGTATAAATCCATCTATCCATCCGGCCAACAAGGCGCACGCAGGCAGCGCCGCGCCGAATCCCCTCCTTGCCCTCCACCTCGACCTCATCTCTCTGT
CCCCTCCTTCCTTCCTTGCTCCGTCTCTCTGTTTCTCTCTCTGTCCCCGGCGCGGCGCAGGGGGAAGAGGCCATGGAGATATTCTACTACGTGGTGTTCG
GGGGCCTGGCGGCGGTGGTGGCGGGGCTGGAGCTGGGCAAGAGCGGCAAGGACCGCGTCGCCACCCCCACCGCATTCAACGCCTTCAAGAACAACTACGT
CCTAGTATACTCCCTAATGATGTCCGGCGACTGGCTCCAGGGTCCCTACGTGTACTACCTCTACAGCCAGTACGGGTTCGACAAGGGCGACATCGGCCGC
CTCTTCATCGCCGGATTCGGCTCGTCCATGCTCTTCGGCACCATCGTAGGCTCACTAGCAGACAGGCAGGGCCGCAAGCGCGCGTGCATCACCTACTGCA
TCACCTACATCCTCAGCTGCATCACCAAGCACTCCCCACAGTACCGGGTCCTCCTGCTCGGCCGCATCCTCGGCGGCGTCGCCACCTCCCTCCTCTTCTC
CGCATTCGAGTCATGGCTCGTCGCCGAGCACAACAAGAGAGGCTATGACCCGCAATGGTTGTCCATCACATTCTCAAAGGCTATATTCCTCGGAAATGGT
CTCATCGCCATTTTAGCTGGCCTCTTTGCTAACCTCCTCGCTGACAACTTGGGCTTTGGCCCTGCTGGCTCCTTTCGATGCCGCCGCGTGCTTCCTGGCA
ATAGGCATGGCCATCATCATGTCCTCATGGAGTGAAAACTACGGAGATCAATCTGAAGGCAAGGATCTCATGTCTCAGTTCAAGGTTGCCGCCAAGGCAA
TCGCTTCAGATGAGAAAATTGCATTGCTGGGAGCCATTCAGTCGTTGTTCGAGGGCTCCATGTACACTTTTGTCTTCCTCTGGACTCCAGCGTTGAGCCC
AAATGACGAAGACATTCCTCATGGCTTCATATTTGCCACCTTCATGCTGTCGTCTATGCTGGGTAGCTCCATTGCATCACGCCTGTTGGCCCGGAAGATG
AAGGTCGAAGGTTATATGCAGATCGTGTTTGCAGTATCAGCCTTCACCCTTTTCCTCCCGGTTGCCACCAGCCTTCTGGTGCCGACGTCTTCAGTGAAAG
GAAGCGGCATCTCGTTTGGGGGCTCTCTACAGCTGCTTGGTTTCTGTACCTTTGAGTCGTGCGTCGGCATTTTCTGGCCATCCATCATGAAGATGAGATC
TCAGTACATTCCTGAGGAGGCGAGGAGCACCATCATGAACTTCTTCCGCATACCGCTCAACCTGTTTGTCTGTGTGGTGCTCTACAATGTGAATGCTTTC
CCTATCACCGTCATGTTTGGCATGTGTTCCATCTTCCTCTTGATGGCGGCAATCTTGCAGAGACGGCTCATGCTTGTCGCTGACCTACACAAGCTATCCA
CAAAATCACAAGATATGACCGCGGAAGACGAGCCTCTAAATCCTTGAAAGGCCAACAGAACACATGCACCTGGGTGCTGGCTGAATAAGATGGAATTGGG
GAAAGCAAAATATGTTTTGATTGTAATATTTCTTTTTTCTGTAGCGTAGATCAGATCGATATTATTATTGGCTAGGCACGATCGAGGACATGGATGGATG
GATACACCAAAGCAAGAATTCAGAGGCTGCTGAGTGAATTGGTATAGGCTATTAATTTTATGATTCCTGCTCTTGTTGTTCATCGGGGGACGGCATTATT
TGTGTTCAATACGCTACGCG
page-top