Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19632  (registered. 2007)
Contig Information
Length 787 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_005128 [Oryza sativa (japonica cultivar-group)]
Score 537
Evalue 5.21223e-53
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19632
TCGTGCCGGGAAGAGGCCCTATGGTGTCGGTCTCCTTGTTGCGGGTCTAGATGAGTCTGGAGCCCATCTCTACTACAACTGCCCCAGTGGGAACTACTTT
GAGTACCAGGCATTCGCCATTGGCTCCCGCTCCCAGGCAGCGAAGACTTACCTCGAACGCAGATTCGAGAAATTCAACGCCTACACCCCGGACGAGCTCA
TCAAGGATGCGCTCTCAGCCATAAAGGAGACCCTCCAAGGTGAGAAGCTGACCAGCTCCAACTGCACCATTGCCATTGTCGGCAGAACGGAGGATGGCAC
CGTCGAGCCCTTCTCCATGATTGACTCCAAGAGGATCCAGGAAATCATCGACTCCATGGAGGCCGCCGATGAGGCGCCAGCGGCCGACGCCCCTGCTGAA
TCAAGCTCGATGCAGGAGGACAGGGGCGATGCGCCTGCGGCAGGGGATGCCCCAGCAGCGGATGAGCCGGCAGCACCGGACGCACCGGCACCCATGGACA
TCTAGGCGTCTTCTGATGATCTATACATGTCATGTCCGTCCACCCCCATTGCCGCAGCGCTATTCAGAGTTTCAAAAAGACTAGACTGTTGTTTTAGAAA
GGTTGCCATCCATTGTGTGTACTCTTTGCTTCTGTGCCACTACAGCTTTGTGGTGCCTGCGTCTGGACTGATTGATTTTTATCTATCATGTGATGATGTC
GCGGACAGAATCGTCTGGTTGGGGGAACAGATTTACGTTTTATTTATCATAAAATCCTGCTACCTGTTGGAGTGTTTAAAAAAAAAA
page-top