Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19580  (registered. 2007)
Contig Information
Length 877 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 2
Wh_RDr Root of dessiccated seed 2
Wh_SHDr Shoot grown with dessication 1
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_02369 [Oryza sativa Indica Group]
Score 221
Evalue 2.75372e-16
Total Hit Count 127
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19580
TTTTTTTTTTGCTGTTTAAACAAGTCGACATAACAAATAACGATCTTGGACTCTGGTTCATAACAAACAGCAAATGAAAGCTCAATGTTACATAACAAAC
AACAGCTCAATCATAAAAGTTTTAACATGGATTGTTTGTAGAATAGCAAATTCATCGTTCAAAGCCTTGTCACTTATCATCACCGTTCTGCACAGCTGCA
CTTGCGCGAGGGTCATCATCGGCTATCATACCCTCCTCTCCCTCTTCATCTATCATACCTTCCTCTTCATCCTCCCTCTTCTTGCTGCTCACAGAGACTT
CCACAGGTTTAGCATCCACCACTGGCTCGCCATTAGGGCTCATTGAGCCCCTGCCTCCTTCGCCATTATACACAGGACTATATGGAGCAGACTTGTCATC
CCGCTCCTGCAGACTGGGCGACCGATCCAGATCAACCTTTCCCATCTTCCCATCGCCATTTGAAGGGTCGACACTGCGGCTCTTGTGATCATTTGAAGGG
TGAGCATTGGGTGAGCTTTTCTTCTCCACTGGGTGGGCAGAGTCAGGACGTGCGGACCCAGAGTCAGCTCTTCTTTCAGTCTTGCGTCTAGCGCCAGGGC
TACGACTCCTGCTGCGGCTAGCACGACGATTCCTAGTGTAACTCCTGCTCCGGCTCCTGCTCCGGCTCCTGTTCCTGCTCTTGTTTCTGCTCCTGCTCCG
GCTCCTGCTCCGGCTCCGACTTCTAGTCCTGCTACGGCTAGCCTGCACATCATGGCGCCGTCTCTTGGGGCTTGGGCTGCGCCTATCACTGTCACTCCTG
CTAAGGCTTCTGCTGCGACCTCTAGCAGACCTGCGAGACCCGCCGTAATCATTCCTGCTACGGCCACCATAATCATC
page-top