Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19447  (registered. 2007)
Contig Information
Length 907 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_SHC Shoot grown with cold treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0416700 [Oryza sativa (japonica cultivar-group)] >gi|38344036|emb|CAE01528.2| OJ991214_12.17 [Oryza sativa (japonica cultivar-group)] >gi|39545714|emb|CAD40930.3| OSJNBa0033G16.4 [Oryza sativa (japonica cultivar-group)] >gi|113564337|dbj|BAF14680.1| Os04g0416700 [Oryza sativa (japonica cultivar-group)] >gi|116310806|emb|CAH67596.1| OSIGBa0092M08.8 [Oryza sativa (indica cultivar-group)] >gi|125548247|gb|EAY94069.1| hypothetical protein OsI_15845 [Oryza sativa Indica Group] >gi|125590354|gb|EAZ30704.1| hypothetical protein OsJ_014187 [Oryza sativa (japonica cultivar-group)] >gi|215686964|dbj|BAG90834.1| unnamed protein product [Oryza sativa Japonica Group]
Score 871
Evalue 1.23644e-91
Total Hit Count 276
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19447
AAGTAGTAGCATTATTCTGCACAGATTCAGAAAAACAGGGTAAGGAAATTGGTGATAATTATACACTATCATATCATGGTTGTTGCTACTCTACAAGATT
TACTCCTGCAAATAATTAAGAGCGCTCGACGTCGCTCTCAGCGTCGCCCCGGCGAGACGACGTGCGTCCGCGTCACTCACACGTCGACGGTGCAGTAGGA
CGGCTGCGTGAACTTGAGCGAGACGGTCTGCTTGCCGCCCACCGTGGCGCTCATGGCGAAGGCACCGCCGACGGAGCCGCCGCTGGCGGAGAGCAGCGCG
GGGCAGTTGACGAAGATGTGGTAGCCGCCGGAGACCCAGCTGCCGACCTTCCACTTGACGCGGCCGTCCACCTTCACGTGCAGCAGCACGTACCCGGCGG
CGATGTCCTGCTTCATGGCGTCCGCCACGTAGGGGGCCACCGGCACCGAGTCCCCGGACATCACCGGCGACCACACCGACTGGTCCTTGTGTCCCTGGTA
GATCGCCGGCAGCGACACCGGCACCGTCACCGGCTCGTCGCGGTACGTGGTGAAGGCGTGCAGGGTCTTGTAGTAGATGCCCACCCGGTCGTTCGGGTTC
CGCGACGCGATGGTCACCTGGACGTCAAGGGAGAGAGCCGGATCGGCGAGGTCGATGGAGCGGAGCTGGATGTCCTGGAGGTAGAAGGAGGGCTTGGAGG
GGTGCAGGGCGAGGTAGATGACGAGCGCGACGAAGCCGACGAGGACGGCGAGCGTGAGGATGCAGGCGGCGATGGAGCCGCAGCACCGCCGGAGGATCCA
GTCGTGGTGAACCTTGCCCTTGCTCATGGTGGCCTGATCAACTGGGCTTCGGTGTGTGTGTGTGTCTTCGAGTGAGGGCTGCTAACTAGGACTGTGGCTG
TTTGCGA
page-top