Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11452  (registered. 2012)
Contig Information
Length 1283 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 2
Wh_KMP Shoot grown under continuous light 1
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
WH_XE Seedling, infected with leaf rust 1
WH_XV Leaves, plant was grown at constant 23℃ 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|212275392|ref|NP_001130060.1|| hypothetical protein LOC100191152 [Zea mays]
Score 549
Evalue 3.00E-154
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11452
TATAGTTACAGAATGGAACAGGACTTCTTAATAAGAACTTGAATTGAAATCGATATCCTCCAAATAAACAGTGTTATGCCTCACAGTAGAACTATTACAA
GAGCGTACGCTACTGCCTAGAAAACCATCAAGTACAGCTACAAACACAGCACGCAGATCTACCTTGACAGTGAAGCTCACAATCAAAGGGACAGATACAT
GGTGAAGGATTGCGGTTGATGAAGATCGTAACATGCATTGCATGCCCGTATTATACTTTGACGTAAAATTTTACAGTGGCGCTATTCTTTCACGTATTTG
GCATCTTTGGCAACTTCATCGTCTTCTTCTTCAAAGTCGTCAAAGTCGTCACTGTCGTATTGTAGAAGGCTGAAGTCCCTAGACTGCGCCTCCTTCAGCC
TTTCCTGGATTCTTTCCTTGATGGCAGTTCCCATTGAATGGCAACCTTCCTCGAATTTCTCTAGAAAACCAACAACCCAGCGATCTGCGTTTTCAACCCA
CTCTTCCTGGAGTTTTGCCACTGTACTCCACTTCTCCCCTACTTTTTCTTGGTGCTGCTTCACTTTGTCACGCAGGGTTTTCAATCCCATATTAACTCTT
AGTCGTTTTTCCTTGACATAGCTGACACCAAGATCATTTCTGCTGTACCCCCTGGCCAGATTGCGCATAACATACTCATTATAATCTTTAACAATCCTCA
TTATAATGTCTGAGGTTGATATTCCTTCTGTGCGCTTGGTCTCCTTAAATTTACCAAGCTTTTTTACAAATTCATAGACATCATTACTAGCTCCACTAGC
ATCATGATACGGCAGAGAATCATGTGCGACAAAATCGATGTTATGCTTGTTCAAGAACTCTTCTGTTACTACCCACGGAGCGTCAGGAATGACTTCATCA
ACCCACTTGCAATGGCGAAGTGATTCATATCTCTCGTCCTCTGTCATGACAGTTCTTCCTTTGTATTGATGTGTCAGCTCATCATTGCAGCACCCGACAA
GAAGATATGCATTAGGGAACGATTTCTTGGCCTGCTCGAGCGAGCGCGCGTGGCCGAAGTGGAAGAGGTCGTAGATGCCGTCGGCGTAGACCCGGATCGG
CCTGTCCGTGATCCCCTCGCCGGCGCCGCCGCCATTGCTCGTGGACCTGTCCGCGACCTCGACGTCCCCCTCGGCCTCCTTCCAGTCCTCCTCCTCCTCC
TGGGAGGACTGCGGCGCCTGCCTCGCCGCCTCGGCCTTGGCGTCGGCCATGCGAAGAGGGAGTCGAGAAGGTTCGGGTAGGGG
page-top