Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19364  (registered. 2007)
Contig Information
Length 599 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 3
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 330
Evalue 2.92058e-29
Total Hit Count 30
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19364
TTTTTTTTTTGCCCAACCATTAACTGATGCGAAACAGAAATTAATTGGCTTCAAAATTTCCTTTTGTTTTATGGCTCTGAGAATCCCAACATGCAAGTGA
CACGAACTTGCAGAGGTTTAAACAGCATTATCCCTGAGAATGGAAACAAAATTCCATGAACAAAGTTCATTAACTAAAATCTGATGATGCAGCTTAAGGC
TAAGGAGAATGCATATCTCCTTTGCAAACAGCACTGCCCTACTTGTCTTGGTTCTCCTCCGGCGCTTCCTGCTCGTATCGGCGTTTGAACTTGGCGATCT
GCCCCAGGCTCTGAGCCATCTGCCGCTTCGCCCTCATGTGGTACACTTTGCCGGTGTGGTTCACCTTGGTCATCATGATGTTGATCAGCCTGCCGCTCTG
CGTCACGTACGAGATCCACTGCATCTGGGGATGAAGTCCCTTCCTCATCCTTCCAACCTGGGGAGGAATCACCAACGGAGAAGAGAGGGGTGCTGCTGGT
CGCCGGCCTGCCGCTCGTCCCTGTCCTCCTTCGCGCTCGCCGCGGCGCCGCCGGACGCCGCCGCTGCTCTTTCTGGTGGTGACTCGAGGAAAAGAGAGA
page-top