Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19338  (registered. 2007)
Contig Information
Length 1214 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit OSIGBa0126B18.7 [Oryza sativa (indica cultivar-group)]
Score 1437
Evalue 4.55275e-157
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19338
GATCTCAAAGGAATTCTTTCAAATTGTTTCAAATTGTGTCAGTACAAGAGATTATCAAAGTGGCAAGCTTATAAACGGCTTTATTTGGCAGATTATCTTT
CGAGGTAAGAATGTACCAAAATCTATCTTGTCTGTAATCAAGTCGTCAATCACCATCGCTCGGTGAAAGAATGCTTTGCCATTCCGCGCATCAAGAACAG
CGTCCGTTCCGGTGCGTTATTACCACCTGACAGCGAGGAATTATTCTGTACACATCCGAGACCATCGCCGCAGTCGACGTTATCATCATCGTTGTGCTGC
ATCTTGTCTAGTTTTTCTTCGATTTGAGCTCCGCCACTCTCTCCTCCGTGGACTTCATAGCTTCTCCGTATATGCTCACCAGCTCATCAACTTCGCCAGG
GGTCATTGTCAATGGCGGTGACATCATAATGCTGTCGCCGGCAACCCTGACCAGCATGCCACGCTTCTGGCACTCCTGTCCGAAGATAGCACCAACACCC
CATTCAGCAGGGAATGGGTCATCTCGTGATTTATTATTGGCGAACTCAGTTCCGAGTATCAATCCTACACCACGGATCTCCCCAACAATTGGACTTCCTG
CAAAGGCCTTCGTTCCCTCCTGGAAGCGTGGAGCGATTTGCTTCACATGATCAGGAATATTCCTTTCCCGATAGATTTTCAACGCCTCAATGGCGACAGC
ACAAGCAACTGGATGGCCAGAGTATGTAAAGCCATGAGCAAATGAACCTAGCTTATTGCTCTGAGAATCAACCACAGCTGCTATTTCGGGGCTAACAAGA
GTCGCTCCAATGGGCACATACGCAGACGAAAGAGCCTTGGCCAAGGTGACTAAATCTGGCTTGATGTTATACATATCAGATCCGAACATGGTTCCCAACC
TTCCAAATGCGGTAATGACCTCATCTACTATGAAAAGGATGTCATACTTCTTAACCACAGCTTGAACCTTATCAAAATAGGTCTTTGGAGGAGGGATGAC
ACCACCAGCACCCATGACAGGCTCAGCAATGAACGCAGCAATTGTTTCTGGTCCTTCCTTGAGGATAAGATCCTCTAAATTTTTGGCAAGTCTTGTTGCA
AATTCTTCTTCTGTCTCACCAGGAAGATGGAAGCGCCAGTAGTGAGGGCAGTCTGTGTGCAGAACAAAAGGTGCTGGCAGATCGAACTTCTGGTGCAGGG
CAGGAAGACTAAAG
page-top