Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19286  (registered. 2007)
Contig Information
Length 717 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0560300 [Oryza sativa (japonica cultivar-group)] >gi|52076949|dbj|BAD45960.1| unknown protein [Oryza sativa Japonica Group] >gi|52077043|dbj|BAD46075.1| unknown protein [Oryza sativa Japonica Group] >gi|113632158|dbj|BAF25839.1| Os09g0560300 [Oryza sativa (japonica cultivar-group)] >gi|215708832|dbj|BAG94101.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215767298|dbj|BAG99526.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218202623|gb|EEC85050.1| hypothetical protein OsI_32383 [Oryza sativa Indica Group]
Score 385
Evalue 1.81934e-35
Total Hit Count 43
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19286
TTTTTTTTTTGACAGGGAGGTAACATTTTGATCTTCCAAAGAACACAACCAGCGGATATTTGAGATGAACCCAAAGAATCATAACTTCAGGAATACAAGA
AAATCAGTACTAACATCCACACACAAGGGGAAACCAAAAAGGAGAACAAACGATGTCTATAACCATAGGATTTGATCCTAAAGTAGATCCATAGAGGCGC
TCATGCATCGCGAGTTTATTTGAATCGCAAACAAACAGGCACTCCTTGTATGTGATAATAAGAAGTCACAAGAGTTACATAACGCTATGGTCGCGTACTT
CTTCCAGCTTCGATCGCTGAGGACCGGTTATGACAAAAGAAGGCACAAAGGTAAAAGAATGACTTTCTCTGTGAAAGTCGGCACATCCTTCAGTACTCCT
TCTTGCCAAAGTTCTTGCACCAAAGCTGGGATGGGATTGGCCGGACTGGGTGGTGCGGGCGTTGCTCGAGCTCGGCGGATTTCATGGCGATGGGGATGCA
GACGAGGAAGATGCCGACCATGGCGATGGCGGTGTTGCGGCGCCAGTGGACGGGCCGGCAATAGGGCCCGCCCGTCATGCTCCACACCTTCTGCCGGAAG
TCGCCGCCGCTCGGGCCGTGGCCGCCATGGTCGCCGCCCATCTCCGCCGCCGGTGCGATTGCGAGTGCTCCTTGGATTGGACGGATTCAACCAGATCGGG
GGGGTCGGGTGCGGCGG
page-top