Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19255  (registered. 2007)
Contig Information
Length 915 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 1
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_RDr Root of dessiccated seed 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0598900 [Oryza sativa (japonica cultivar-group)] >gi|113596037|dbj|BAF19911.1| Os06g0598900 [Oryza sativa (japonica cultivar-group)]
Score 796
Evalue 6.26111e-83
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19255
CAGCAACACGAGGCAGTGGCGCTGGAAATGTCTTTTTGTTTTTCTGCCATGTTCTCCAGCGAATATCAACCAAAACAACACCATTTCGTCTATCATAGTC
AACACAAAAGGGTGGGACAAAAATGTGTCAACACAAAATACACAATGGCATCTCAATCTAATCCTGATCAACACCTCATCCACAAAATGTTCTACTCTTG
GCTTATTTTCGGTGTACCAAAAAATCCCCAGCATTTGCTCGATGAAGGGCAAGATTTTTCCCACGGCGCAGTTAACTACTCATACAAGCCAGCCACACTT
GCGTCGGACACCGGCTTTGACGAACAGACGCAAGGCAAGACGGAAAGAGCAGCTTTGAGGATAACAACAGCATCTCATCCAACGATGTAATCCTACTCCC
CGGCCTTCTCCTCCTTGGCAATGTGGAAGCCTTCAATCTTACACGCAATCTCCTCTGCTCCAGCCTTGGGCTTACCATTTGTATCGATCGCCTCCTCAGC
ATCCGCGTTAGGTGGGCTCAGCTGCCAGATCCGAATAGTACCATCTTCCGACCCTGAGGCGTATGATTCACCACCAGGTGCAAACCGGACGCAGTGAACT
GGACCATGATGCCCTTTGTTACAAGTTATTTCTTCACCAGTAAGGAAATCAAATACATGAACCCACATATCTTCTCCTCCAGCAATGAATTTGCTGCCAG
ACTTTGGTTCAAGTGAAGCCGACTCCACAATAAACGACATATCATAGCTTTTAACAAGCCCAAAGTGATTAGCATCCCAAAATTTTACACTTGAGCCATC
AGCTGTGGTGATGAACCTGCCATCCTGGCTTACTTCTGCACTGGTAACAGGTCCCTTGGTTTCAAGAGTTTGGACAATTTTTTCACTCCTCACATCCCAT
AACCTTACTCCACCA
page-top