Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19226  (registered. 2007)
Contig Information
Length 977 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_OKCS Seed DPA5 2
Wh_VWD Shoot grown with dessication 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit protein S1 - Phalaris coerulescens
Score 707
Evalue 1.45554e-72
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19226
ATCCCCCACCCCTCCTCCTCTTCCTCCGATTAATCAAACCGCGCGGCGGCGGCGGCGGCGAGCGTGCGACCTACGACCACCAGACGACCCAACCGACCCA
CTGACCCACACCACCGGAGAGCTCTTCCTTTTACGTCAATCAATCGAACCCAGTTAAAGAACCTCTTAATTGCCCGCCAGGAGATCCGCCAGGCTTATCT
TCTCCGTCTCCTCCGACCTCACCTCGCCCCCTCGCCCCGCGGCTTCTGGGCTCCTTGGCGCCAAAATCCCCGCTTCCGATCCCAGGCGTTCAGGAAACAA
GGGGCCTTTCATTCAGCGATTCCTGCCAGTGTCAGTTCGCCATGGGGGGCTGTGTGGGCAAGGGTCGTAGCATTGTGGAGGAAAAGCTTGATTTCAAAGG
TGGAAATGTGCATGTCATAACAACCAAAGAGGACTGGGACCAGAAGATTGAAGAAGCAAACAAGGATGGGAAAATAGTTGTGGCAAACTTCAGCGCTTCG
TGGTGTGGGCCATGCCGTGTCATTGCACCTGTTTATGCTGAGATGTCCAAGACTTACCCTCAACTCATGTTCTTGACAATTGATGTTGATGACCTAATGG
ATTTCAGCTCAACATGGGACATCCGTGCAACCCCGACGTTCTTCTTCCTCAAAAACGGCCAGCAGATCGACAAGCTCGTCGGCGCCAACAAACCTGAGCT
CGAGAAGAAAGTACAAGCTCTTGGTGATGGCAGTTGAACCATGCTACAGAATTAGAACAGAGCCAGCTTGTCATTGCTTATATATCTGTATTGCCATGCT
TGTGTGTCTTATGTGTTGCATGATAGTTTCCTGGTGTACAGTTTCCGTGTCTTTTCCGTCTAGACAATGTTTTACAATTTTGCGACACGCATATGCATAT
GCTGTGAAAACTGTAAGATGACCCTGCTGGTAAAATGCTAGTTTTGTGAGAGTGTCATCTGCTGGGGAAAAAAAAAA
page-top