Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19215  (registered. 2007)
Contig Information
Length 1489 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0570400 [Oryza sativa (japonica cultivar-group)] >gi|52077187|dbj|BAD46232.1| putative sialin [Oryza sativa Japonica Group] >gi|113632219|dbj|BAF25900.1| Os09g0570400 [Oryza sativa (japonica cultivar-group)] >gi|215694432|dbj|BAG89449.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218202668|gb|EEC85095.1| hypothetical protein OsI_32467 [Oryza sativa Indica Group]
Score 1626
Evalue 7.29792e-179
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19215
TTTTTTTTTTGGCAGCAGCTGCAAACATGGTTAAAACATCGGTTTCATCAGGAAAATAGAACAACCATGTGGAATTCTTTAGTTGGTGCAAAAGCTGAAA
CAGGGGGAAAGTAGCTTGGAGTCTTGGGACTTCCTCCAGGAATAAACAGACGCAAGGTGCTAAGCTAGGATTTGGTGCAAGGTGTGGCATTAATTCCCTC
CGTGCAGCAGCGCTTTCAGATTCAGAGAATTCTTTGGTTCCAAGCCTAGCATCTTGACTTTCACAGCAAAAATTTAACCAAGTGTAAACATCAAGTGCGG
CTCTTCTGTGTGATCTTCACTCTTTCCGCAGCCCGAACATCAAATGCAGCTACTGTATCTCTTGCTAAAAAACGCGAGTTTTTTCATAGGGTATCTCTCG
CTCTGGTTTACTTCTTGCGTACACCAAAAAGACAGACATCAGCAAAAATCAGCTTATTTTCGTATAGCGGCGCGCATAGGAGCGTCCGTCCCATGGCTTA
TTCGAGGATCCTCTCTCCGGTCGAAAAGACGTTCCACACCACTGTCCCTACTATGTACAGCAGAACAGCCACCTGAAACACGCTGTCCCAAGAGCCTTTC
TGAAGGATGTAGCCAGTGGCAGCAGTACCAAAAACTCCTGCAAGCACGCCGGCGGTGTTCGACAGCCCAAGAAGCACCCCCGCGTAACGCGGTCCTATAT
CCTGGTGGTTCGAGTACAGCCCAGACTGTGAAAAAGCATCACTCCCCTGACTGCATGCCATACACAGCACGGCCATGGCTGGTGTGCGGACTTTGCTCAG
CAGTGTCAAGAACAAGGCTGGTCCAAGAAAACCGATAGATTGCATGATCTTGCGAACATTTGTTATCGAAACCCCTCTCGCAACAAGTGTGTCAGCTATC
CAGCCACCAACGTTTGCAAACACGGCCATTGTCAGCCACGGCAGGACACACAGAAGCCCGGACTCGGTGAGATTGAACTTCAGAACCTGATTGTAGTATG
TGGGCATCCATGTAAGGAGAATGAATGTTCCCCAGTTATGGCAGAAATGTGATACTATGAGGGCCCATACTGCAGGCTTTGATAGGATTAACTTCCATGG
TATGGAGGTAACAGGCTCCTTTAAGGTACTACCACCTAGTATGTGCCTCTTTTCATCTTCGGTTACTTCCGGATCTTCACTCGGAGAGCTGCGCGCTTTG
AGTTGCCACAGTGTAAACCAGATGCTTCCCAGGGACCCAAATCCGTAGAAAACAGAAGGCCAGCCGAATTTGCTTATCAGGAAAGGTGAGAAGGCTAGGC
CGGTAACTGAACCAAGGTACATTCCACTGTATACTAATGCAAGAGATCTGCTCCTCTCTGAAACCGGGATCCATTTGGAAAGGATGTTGTTCATGGCCGG
CATGGCGACACCCTCGCCTATCCCCATGAAAGCACGCACGACGAGTAGGAACGGAAGGCCAAGCTTGGCAGCAAATGGTGTAAGAATGT
page-top