Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19183  (registered. 2007)
Contig Information
Length 1545 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_SHDr Shoot grown with dessication 4
Wh_VABA Shoot with ABA treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_38641 [Oryza sativa Indica Group]
Score 817
Evalue 4.91372e-85
Total Hit Count 290
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19183
GCCATGGTCATCAAACAGGTGACAAGCCATGTAATCCATGTAACGTTGGCCTTCCCGAAGTAAAATGAAGCACATTGGGACCCCAAAAATCACAACACCG
AACCCGCTCCGCTGCTACACACAACCCACCATCAACCGAGCAAAAAGGACGCTAATATACACCTACTGGTTGAAGGTCCGCTGGCATGTAGCAGCTGCGA
ATAGTCGTCGAATCAACACATGCACAAGGTGGAAGGAAGAAGATGGATGCAGTAAGCAAACAGCAATACAATAACAAATAATGGCGGGTGGGGCTTTCAC
TTGATCACTTCATTGTTTCCCCTGACGGCATGACCGGCCGCTCCAGCTTGGACGTTCCTCCTTGAGCACCTCAAGCAGTCAAAGGAGGTGATGATGCACG
GTGGGCGGACTTCTCGAGTACCTTACACGGGCGAAGATGGTCCTCATAGTAATGTTTAGAAGAGCTCTTCAGAGTTAAATTTGTTCCAGGCCTCCTTAAG
AAGATCAAAAACCTTCTCGGCGATATATTTCTGCTGTAGATTTGCACCCTTTTGTTGCACCTTATCAGGATGGATGCACAAAGTTGCCTTTCTGTACACC
TTTTTAACCGCAGCAGCAGTGATCAGATCTGTTAGGGATACAGGCTGCCATCCACATTCTGGCCAAAGTACATATTGCATAGTTGATAGCAGTGCCCGCA
AATTGCCTTCTTTTCCAGCAGCCCATCGCTTAATCTCGAAGTCTAGACTTTCCGAAATTCTATCTCTTTCTGCCTGCTCTCTTTGAACATTCATGTCCCG
TTCATTCTTCTCAGCCAGGGCTTTTGCCGCTCGTTCACGGGTCCGTTGATGCCGCTCCAACCTAGCACGTCTTCTCTCTTCACTCTCTCCTTCAACCGCT
TGAAACTCATCAGATGGCGTGGGAGCTCCTCCAAATATCGCGGATAGGTCATCCGTAAAATTAGTTGTAGATGATGCCTTCCGCATAGATGATGCTGAAG
CAGAGGTGGCTGCCGCTCTACTTTGACTTTGAGCATTAAACGTAGGATCCACTGTTGGAGCCCTTTGCTTAGGTGCACTGTTTGCTCGGGCACCCATACC
AAAAAAGGACTCAAGGTCATCTGGTTTACTCTGTTTTTCTCTTGCCGCTGCTGCCGCTGCAGAAGCAGCGTGCCTCTCTCGAGCCTCAGCAGCTTGCCTT
TCCCGAACCTCAGCTGCGGCCTTTTCCACTGCTGCTCGGTCAGCTCTTCTCTTTGCATCTTGTTGAACTCTCTCAACAGCAGCTCTTTCTGCTGTAGCCC
TCTCCCTGGTTTGAGCAGCAGCCTTCTCCTTAGCTTCAGCAGCAGCCCTATCAGCTCGGTCTCTAGCATCCACTGCAGCTCTCTCACGAGCTTCCTGCTG
AGCTCTTTGCACAGCAGCCCTCTCATTACGTAGGCGTGCTTCCCTCTCTGCTTTTGCACGTGCTTCGATAGCTGCTCTTTCCCGTGCCTCCTTCGTCGCC
CTCTCCACAGCTTGCCTACCCCTCCCTCTTTCTCTCTGTGCTCAA
page-top