Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19180  (registered. 2007)
Contig Information
Length 736 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_15493 [Oryza sativa Indica Group] >gi|125590009|gb|EAZ30359.1| hypothetical protein OsJ_013842 [Oryza sativa (japonica cultivar-group)]
Score 165
Evalue 6.27902e-10
Total Hit Count 13
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19180
CACACACGGGATTAGCTAAGCTACCATGGGCAGAAAGGTGTGCATCTCCCCTGCAATCATCGCGCTTGTAGTGCTTGCTGGCCTGCGCGCGAATGCTTCC
GCCTTCGCCGGCGGTGCCGCTGCCAGCATGGACGCGGCGCTGGCTGTGCGGCAGCTGACGCCAACGCTGTCGTCGATGAAGCTGGAGGACGCCGTGTTGC
CGGAGCTGGCGGTGGACCTAGAGGTGCACCGCCGCATCCTCTTGGGCATCCCCCAGCGAACCGAGAACCGCGATGGGCCAGCCTGCCTGAAGAATGGGTG
TCCGGCGGACGGAGGAGCGTATACCGACCGCGGATGCCTCAAGAAGTACGGCTGCTCGTTAACGCCACCACAGTCCACAGTGAACTGAAGGGCACTACGT
ACGGGCGTCAATGCAACCTCCTTCCTGCACGCCGTCCGTTCATGGGCGCACTCGCGTTCCATCCATCCATCCATGTTTTATTTCCTTTCCATTTTGCATT
TCAGTATCGTCGTTGCTAACTTTTCTGTCGGCATGTACGTACCTTGAAATGACTTGGTATTCCGTACTACGTAGAGTTGGCATGATTGTGCAAGCGACAC
GGTTGTACCATCCGGCTGATGGTCGATACTATAGTTGATGTTATCTTACGTCCAGTTTGCACTTAAACACAAGTAAAAACAATTTGTACATCTCCTTGGA
ATAAGATCTCACTGCATTTGGATTCCAAAAAAAAAA
page-top