Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19177  (registered. 2007)
Contig Information
Length 1089 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_SHDr Shoot grown with dessication 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08703 [Oryza sativa Indica Group]
Score 933
Evalue 5.00899e-138
Total Hit Count 280
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19177
TTTTTTTTTTCGAGAATAACAGCACTGCTATTATTTAATTTTCACAGGTGCTATCAGTTCAGTACACCAGAGCATGAGCATCCACTATAACTTAACAGGG
GGATCAAATGGACATATACTTAGCATGGATATAGATAGGGTTGTGTCGAAAATAGACCGGCGCAACCTCGTTATGTCAACAAAGTTGAATGAAGATACAA
GTATCAGCTTGGATTATCGCAATTCGCATTCTGACCATAGAAGGCAGACCAACGAGTCACCAAGTCACCAGATTAATCGGCGGTCTGTGTGCACCTAAAG
TGCAACCTTCCCTTTCAGATTGATCGCCGAGAGCTCTTGTTCCACATACTCCCCGGCACATATAGGCGGATAACTATGAGCATTGGGTGCTTCAGCAAAG
TGGCCCAATGGCTTAAGCGTCGCATCGGAAGCAATGTGCGAGAATAGCGTTGATGAGATCCTCCACAAGCTTCGGTTCTGCTCTTTAGCTAGTTCTATTG
CCTCTAATGTTCTCTTGGTCACCACTACCTCATGCATTCCAGCTAAACATTCACCACCAGTAAGCCATTCCAACTGTTTCCCTGACTGAATGAGAAGACA
GCCAACAGGAACCTTCACCTCCATCTTTTTACCATTTCTTAACCAAATGTTCAGGCCTGGAAATCTACTACGGCCATGTATGGTCAAGAAATTAAGATCA
TAATGGAACCCAGCAAACACAGTGCCCTCAGAACCATGACGCAGCAGATTACTTCCCGTTGGTGCTAGGAGGTGCGGTCCCTCCTTCATCAAAGAGGTAA
ATGCATCCTTTGACAAGCCAAATCCAATCGCCGCCATCTCAGCAACAACCTCAATTGCAGAAATCATTTTTGCACCCCCAGGAATCCATGGTCTCTTTCC
ACTCAGGTAAGCCATCAGGAATAACAGGTTCTGCGTTCAGCTCCTTAAAGCGGGTATTCGACGGGCGAGGGCCCACTCTCCACATGTAGCGCCACTTAGG
GTCTGGTCCCTTAGGGGTGGCTGGTTGAAACTCCTCTGGCATACTCTTGATCCTGTCTTGCATCTCCTTGTCGACGAGGCTGCGAGGTA
page-top