Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19123  (registered. 2007)
Contig Information
Length 392 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0712000 [Oryza sativa (japonica cultivar-group)] >gi|41052655|dbj|BAD07503.1| DegP protease-like [Oryza sativa Japonica Group] >gi|113537436|dbj|BAF09819.1| Os02g0712000 [Oryza sativa (japonica cultivar-group)] (no hit)
Score 912
Evalue 2.59942e-114
Total Hit Count 0
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19123
TTTTTTTTTTCGCAGCTATGACTTGCATTTTCTTCATCCATTTAAACTTGTTCAAACATAGGATATTCCAACATCACATCCCAATCCATGACAGAAGGGG
ATTGCTGCATCACCGACTGACCGACCGACCGACCGACTGAAAGATAGTAACACATGTTGTTTCTTCCTCGCGTAACCAGCTCTAATTAACCCCGGACAGA
GCGACACTCGAGCTCGCGATCAAAAACACCACACACACGACGACTCAGACTGACACAGGAACACGACGACACCGAAGATAACTTGCTAACGAAGACGACG
ACGACGACACGGTAGATAGATCGATAACTGGGAGATTCGAGGCTCAGTTCCTCCACTGGCCGCCGGAGTCGCCGCCGCCACCGCCGCGCTGG
page-top