Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19074  (registered. 2007)
Contig Information
Length 1250 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_PCDAM Anther at meiosis 2
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0618500 [Oryza sativa (japonica cultivar-group)] >gi|38344323|emb|CAD41739.2| OSJNBa0058K23.5 [Oryza sativa (japonica cultivar-group)] >gi|38345613|emb|CAD41896.2| OSJNBa0093O08.15 [Oryza sativa (japonica cultivar-group)] >gi|113565463|dbj|BAF15806.1| Os04g0618500 [Oryza sativa (japonica cultivar-group)] >gi|218195591|gb|EEC78018.1| hypothetical protein OsI_17434 [Oryza sativa Indica Group]
Score 1329
Evalue 1.57407e-144
Total Hit Count 411
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19074
CGGATCTCAGAGAGGAACCGGATCCCTTCCTCCCTCCGAACGGCAGCTCGGCAGCTCAACTCAACCCCAACTCAACCCAGCCCAGCCGTCGTCGACCCTA
GAGAATCTGCGAGGAGCAGCAGCGGAGAAGAAGAAGGAGACGGTGGTCTCTCTCCGCCATGGCCAGCTCGTCTGCCGACCCGGAGAAGCTCATGGCCAAG
GCCGACAAACTAACAAAACTGAGCTTCACAAGATGGAATGCTGATTGGAAGAGTGCTACCGCCTTGTACGAACAAGCTGCAATTGCTTATAGATTCAGAA
AGGACAATGAGAAAGCAAAGGATGCATTTGAGAAGGCTTCAAAAGGACAAGAAATGATCTCATCACCGTGGGATGCTGCTAAGCATATGGAAAATGCTGG
TGCTTTAGCAAAGGAGCTTGGACTCTGGAATGAAGTTTCCGACTTTTATCGCAGAGCATCAGAATTTTACCGTGAATGTGGAAGATCACAACCTGCCTCT
GATGCTCTTGCAAAGGGTGCCAGTGCCTTGGAAGATAAAGCTCCAGAAGAAGCAACTAAATTGTATGATGACGCTTGCACACTTCTAGAAGAAGATGGAA
AGGAGCAGATGGCTTTTGACTTGTACCGTGCTGCTGCAAGTTTATATGTGAAGCTTGAGAAGTACTCGGATGCCGCTGCATTCCATTTAAGACTTGGTTC
AGCTGCTGATAAGTGCAATGCCGTGAACAGCCAATGCAAGGCCTATCTGAGTGCAATCATTATCTACCTTTATGCACATGATTTTCAACAAGCTCAGAAA
TGCTACAATGATTGCTCAGAGGTTCAAGGCTTCTTGAATAGTGACCAGAATCGATGTGCAATGAAACTGTTGTCTGCTTATGAGGAAGGCGACGCTGAAG
AAATCAAGCGTGCTGCTCAATCAAGTGCCATTAATCACCTCGACCATGTGGTAATTCGGCTTGCAAGGAAGCTACCAACAGGTGACCTGCAGGCCATCAA
GAAAGATGTAGGAGGCGACGACGGGGATTCCTTGGACGAGGATGACCTAACCTGATCCCAAACTGCCTGGCGAGATGCAGAGAGAACCACAATCAATCTG
AATGACTACGCCATTGATGAACAGGAAAGGTTGTAAAAACACATTCTGAATCGCATAGATACTTGTAGGCTGCATCTGTATCATGGATTTCGATCCCCTT
GTTTTCGTTGTTCCGGATCTGTGCACATACACCCTACATCTGTACCGCTG
page-top