Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19069  (registered. 2007)
Contig Information
Length 999 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_VABA Shoot with ABA treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit serine/threonine kinase [Sorghum bicolor]
Score 837
Evalue 1.27813e-87
Total Hit Count 397
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19069
TTTTTTTTTTAAATTAACTCCATGGTCTCACAATTTACAATGGGAACGAACGAAATGATGACCGGCCGATGTGAGTTTACAAGCATATTCGGCTAAATGT
TTGCGAATTCCTGATTGCATTGTTCCAAAGTGAACTCGATACGACTTGCGAAAACCCACATGCCTAATATACAGCAAAACCTACTTGAATGTGCTTGACT
TAAACTGTTCCAAGAAGTCTCTCAAAATGCAGCATATACAACACCAGTGGAGGACAAGCACAGCTGACAACAGGGCTATCCATCGGTACTTACAAAATGC
GGTGAACAATTTTTTCTTGATCCAGCTCCTGAGAATGGATCAACTCAGGAGGAATGGGATGCTAATAGTTTACCCATTCCCCCTTCTCCCAAGCTGCTGC
TAGGAAGGTTGGATCTGAAGATCGTCGGATTTCCAAACAACGTCCTTCAAGGTGTTTGAAAGGTTCTTGTAGAACTTGTGAAATTCTAGAGTGTCACCTT
TTGCTTTGCGAACTTCAACCATATGAAGAGAAGGTCCGACTCGCAGTATCTCGGTAGCAACATTGAGGTTCCCCTTCCTTCCTGCTTTTACCTTTTCTAG
TCTCAGCTTGTAATTTTTCTTCTGAATATCAAATCCTAGAGGCTTTGCAGCTTCTTCAATCTTGCGGAGAATTTCTTTAGGCGAGCTTTTAGATGTAAAC
CTTGTTTCTCTTTTAAATTCCTGCTCAGAGTCGAATAAATTTCCAAGATTGAGGCCTGCTGACATAGAAATCAGTTCAAATGCATTCAGAGCTACTGGTT
CTTCTTCTTTCTTTTCTGTTACATGGTGCTCTTCTGAATCATTGAAGACAGCATCCACATCATCCAGTGTTGTGTCATACTTCTCATCAAACTCCGCACG
CTTGTAACCTTTCTTGAACCACTCATCCTCTAACATTTCTTGAACTGTTATTCTCGTCATCGGATTTGGATCAAGGGATTCTTGGTTAACAACCTCTTG
page-top