Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig11419  (registered. 2012)
Contig Information
Length 864 bp
Clones alternative view 22 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 1
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 1
WH_XA Root 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226530284|ref|NP_001147673.1|| pollen-specific protein SF3 [Zea mays]
Score 374
Evalue 8.00E-102
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig11419
TTTTTTTTTTCTTCCGAAATGACATTCAACTCCATGGTTCAACAACGTGATCGAGCTAGCCACATATGGGGACACGAAATATAGTCCTGGTATCCCCAGA
GCTAGAACACAGCACACAGCAGGTTACAATCGTAAAAAAAGAGGCGCTTTCCAAACTTTCGCCCTCAAAGCCCACTATGAAGATGGCAGCATAATCAGGA
GGATTCAGCAGCCGCCGGAGCTGTTTGTGCCGCCGCCTGTGCTGTTTGCGCCTCTGCTGCGCGCTTGACCGATGCGCACTTGATCAGATGGTTGTAGCTC
CCCTTCTCCTTGAAAAGCTGGGAGAAATGGTGCTTGCAGTAGAGGATGCCTTCCAAGGCCGCGTAGTTGGACGGCGAGAGGGCGCAGCCTCCATGAGAGC
ATTTGAAGCAGGACTTGTGGTAGGACTTCTCTTCAACTGTCACCTTCTCAAGAGGGTATGCTGTTTTACCACAAGTGGCGCACTTGTCCTGCGTTCCCGA
AAACATGCCCGCAGCTTTGCTTGGCGATCTGGTCAGCTCAGGAGTCAACTTCTCCGTCGCAGATTTCGCGGGGGATTGTGACTGGAAGCTCTTGTTGTAG
CTCCCGGTCTCCTTGAACAGCTGCGCGAAATGGGGCTTGCAGTAGGGCACTCCTTCAAAGGAGGAGTAGCTGCTAAAGGAGAGGGTGGACTTGCAGTGGT
GGCACTTGAAGCAGGCGCGGTGGAAGACGGCGCCGTCGGTGGAGAGCTGGTCCATGGGGTACACCGTCTTGGTGCACACCTTGCACTTCTGCTGCGTCCC
GCTGAACATGGTCGCCGTCGCCGTCGCCGCCGCCGCCGCCGATCTGATCTCGGCCTGCGCGCGC
page-top