Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18983  (registered. 2007)
Contig Information
Length 750 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 4
Wh_SHC Shoot grown with cold treatment 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2B.4; AltName: Full=H2B153 >gi|531054|dbj|BAA07159.1| protein H2B153 [Triticum aestivum]
Score 484
Evalue 6.56096e-47
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18983
CTCCAGCCCAGTCAAACTTCTCTCGACCTCGAAGCATCAGCCGCCGCACCATGGCCCCCAAGGCAGCCGAGAAGAAGCCGGTGGAGAAGACCCCCGCGGG
CAAGAAGCCCAAGGCGGAGAAGAAGGTGCCGGCGTCCAAGGAGGGCGGCGACAAGAAGGGGAAGAAGAAGGCCAAGAAGAGCGTGGAGACCTACAAGATC
TACATCTTCAAGGTGCTCAAGCAGGTGCACCCGGACATCGGCATCTCCTCCAAGGCCATGTCCATCATGAACTCCTTCATCAACGACATCTTCGAGAAGC
TCGCCGGCGAGTCCGCCAAGCTCGCGCGGTACAACAAGAAGCCCACCATCACGTCCCGGGAGATTCAGACCTCCGTCCGCCTCGTCCTCCCCGGCGAGCT
CGCCAAGCACGCCGTCTCCGAGGGCACCAAGGCCGTCACCAAGTTCACCTCGGCCTAGTTTCCTGGTCTGATTCTTGTGTTCCCTTCCTGGTCCTTGTCT
GATGAATTCTGTAGGTAGCTGTGTTCTGACAGTGTCATGCGACATTGTCATCTTGTAACAGAGTTTCTGCTTGTGGGTTTGTGGCTGTTATTCGGTCTGG
TTAAATAGTCAACTTCACCTCATCCTAGTATTCTCATCTAATGTGGTGAACTGTAGTTAGATGTGTTCTGAAAGTGTCATCATGTAACTTTGTGCTGATG
GTGGCTGTTTTCAGTCTAAATAAATAGTCATGTTGCTGCTAAAAAAAAAA
page-top