Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18960  (registered. 2007)
Contig Information
Length 787 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_VABA Shoot with ABA treatment 3
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays]
Score 862
Evalue 1.06602e-90
Total Hit Count 366
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18960
TTTTTTTTTTGAAGGCAAGACGGCGGATCATTTATTTCACAAGCCGGCTTTGATATAGAATGATATACCAGTAGTTATTATTCTCCAGAGCGTCGAAAAA
GGAATTATGAGCGGGCGTAACGATTTCTCTAGCTGAAACAAACATCAGCTCAACGGGCATGGTGGTAATACACCACCTTATTATCCTATATATTCCTCAT
GATCATGATCCCGCCCGGCGACGACTAGGCCTTGTCCGTTTTCTTGCCAGGGAATGACCTCCCGCTGCTTGTGACGAGGTTCTTGATGCTCGCCTGGATG
TCCTTGTCCTCCAGTATGGACTCCAGTGGCACATGTAGGCGGAATCTCCAATAATGCCTCGGGTTAGTGGGGTCGTTGATTGTTTCCTCCGCTGCTGGTC
TTGCGGTGTATTTGTCTTTCAGCGCGAGCAGATCCTGTAGCGGAAAGATTGCCCACATTGACGGTGCATCGAAATGCTGCTGAAGAATGAAGTTCACTAC
TTCTGGGGTGCAACGAGATGGGGCCTCTTTGTCGCTGCCAATTACAGTCTTGTAAAAACGACTTCTTGTCCCTTCATCTCCTTCCCACCAAGCACGTAAT
GTGGAGCAATCATGACATGAGGGAGCACAAACCGTCATATAGCTGTACTTGGACGGAATATCAAATTCCAAGCCTGGTTCACTAGGCATTCTCTGGATAC
GCAATCCAATCAACCCGAGTTCTAGCATAACAGGGTGAACACAAGCAGGGATAAGGCCAAGATCTTTCCCCGCATGCCAACATATCC
page-top