Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18940  (registered. 2007)
Contig Information
Length 915 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMP Shoot grown under continuous light 2
Wh_VSCB Liquid cultured tissue 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100194331 [Zea mays] >gi|194695542|gb|ACF81855.1| unknown [Zea mays] >gi|195624594|gb|ACG34127.1| ras-related protein RIC2 [Zea mays] >gi|195643338|gb|ACG41137.1| ras-related protein RIC2 [Zea mays]
Score 1035
Evalue 1.21065e-110
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18940
GCCGATTGCCTCAAAGACCATACAACAATATGAAGGAAGGTCTCACCTCATCTAGACAAACTTCCCGGTTCAGCAACAAACTTCAACTTCTCTAGGTAAC
ATTCATAATAATAATACTTGCTACTACTGCTACTAATAATTCCCGGTCGCTGGAAATGCCACATCACAAAAGCTCAGCAAAAAGAATGCATCATGGCGCC
TCAGCTAGAGCAGCACCCGCCCTTCTTTACCGCCGAGACATCGTCCTTCATGTTGATCTTCTCACCCTTGCCAGGGCCGGCGGCCGAGTCTTCGCCTGCC
TCGACCGCCCTCTTGCTCACGATGCGGTAAATCTGTTTCAAGACCTCCGCAAACGCGTCCTCCACATTGGTCGACTCGAGCGCAGAGGTCTCCATGAAAT
AGAGTGACTCCCTCTCTGCAAACGCCTTCCCTTCGTCAGTTGGGACGGCCACGAGATGGCGGAGATCAGACTTGTTGCCAACAAGCATGACAACTATGTT
CGGGTCCGTATGGTCCCTCAATTCCTTCAGCCAGCGCTCTGCATTCTCGAAGGTTGCGTGCCGAGTGACGTCGTAGACAAGCAACGCTCCTACAGCACCA
CGGTAGTATGCGCTAGTAATAGCACGGTATCGTTCCTGGCCGGCGGTGTCCCAAATCTGGGCCTTGACGACCTTGCCGTCGACCTGGAGGGAGCGGGTGG
CGAACTCGACCCCGATGGTGGACTTGGACTCGAGGCTGAACTCGTTGCGGGTGAAGCGGGAGAGCAGGTTGGACTTGCCGACGCCGGAGTCGCCGATGAG
GACGACCTTGAAGAGGTAGTCGTAGTCGTCCTCCGCCCCGGTACCCCGCCGCCATTGCTCCCGTCGCGTCGGCGATCTGGTTGTTTGCGGGGGTGGCGAA
GGAGGAGAGCGAGAG
page-top