Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18929  (registered. 2007)
Contig Information
Length 702 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 6
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative avenin-like a precursor [Triticum aestivum]
Score 591
Evalue 2.24939e-59
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18929
GATAAACACCAAAGCAAGCTTATAGCCAGCCACCATGAAGACCATGTTCCTCCTCGCTCTCCTCGCCTTCACGGCGACAAGCGCTGTTGCGCAGCTGTAC
ACTACCTGTAGCCAGGGCTACGGGCAATGCCAGCAGCAGCCGCAGCCGCAGCCGCAGCCACAGCCGCAGATGAACACATGCGCTGCTTTCCTGCAGCAGT
GCAGCCAGACACCACATGTCCAGACACAGATGTGGCAGGCAAGCGGTTGCCAGTTGGTGCGGCAACAGTGCTGCCAGCCGCTGGCCCAGATCTCGGAGCA
GGCTCGGTGCCAGGCCGTCTGTAGCGTGGCACAGATCATCATGCGGCAGCAGCAAGGGCAAAGTTTCGGGCAGCCTCAGCAGCAGGTTCCGGTCGAGATA
ATGAGGATGGTGCTTCAGACCCTTCCGTTGATGTGCAGAGTGAACATCCCACAATATTGCACCACCACCCCGTGCAGCACCATCACCCCCGCCATCTACA
GCATCCCCATGACAGCTACCTGTGCTGGTGGTGCCTGCTAAGATCTGTGATGTGCTAGCTAGATCGATCACCGTTTAGTTGATCGATGAAGAGCTACAAA
ATAAAAGTGCCATACATCATCATGTGTGGCCAGTACTATTGCAACTTGGAAATAACAGACCTCTGTTTCTGAATAAAGCTTTTGTCCGAATAAAAAAAAA
AA
page-top