Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18925  (registered. 2007)
Contig Information
Length 618 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 4
Wh_PCDAM Anther at meiosis 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein [Zea mays]
Score 283
Evalue 8.76946e-24
Total Hit Count 17
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18925
CACAACGCCGTTCCAATTGACCAGTCGCCTGCCTCCGCCCCCTTCGCGAAGTTTCCGCGCTCCACCATTTCGCCATGGCCGGCGGCGGCATCTTCAGCAG
GGCGCTGAGCTACGTCGTCAACGAGTTCCTCGTCGAGGGCCTCGCCAACAACCGTGCCTTCCAGAGGTTTGCTGTGAGGACCAACAGGACTTTAGAGGAA
CTCTCATCTAAAGCTAAGCAAGCGAGGGAGGAGATATCGGAGCAATTTAAGGATGCTCGTGGACCCGATGATCGCTTCAAGCAGTGATGCCTTCTATCCG
CGTTCCGAGTTCTGTTCTTGCCCTGGTTCTGGATGCCATCCGCAAGTGGCCATTGTATAAAATCCGAATCTAAATCATCTTATTTTCTATTTAGAAATTG
AGAACTAGACGCAGTGCATTATTGCATTTCTGCAGCCTGCCCAACGGAAGTAATTTGAGAGGAGAGACTCTCCTTGGCTGGACCTCCGTTTTGCAAATTT
CTATGCTTAATGTTGTTTTATGGGTAGTAATATGTACCATCGCAGTCGATCTGTTGTTATGCCCTTTGCTGGCAAATCTATATAACTCTGGCTGCGTCGA
TAACCTGGAAAAAAAAAA
page-top