Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18866  (registered. 2007)
Contig Information
Length 619 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 1
Wh_SHC Shoot grown with cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glycine/arginine rich protein 1 [Bos taurus] >gi|189031302|sp|A6H7I7|GRPP1_BOVIN RecName: Full=Glycine/arginine-rich protein 1 >gi|148878424|gb|AAI46262.1| GRRP1 protein [Bos taurus]
Score 76
Evalue 8.83069
Total Hit Count 3
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18866
TTTTTTTTTTAAAACATAAATAAGTCATACAAGCATCATAATACAAGCCAGGGGCCTCGAGGGCTCGAATACAATTGCTCGATCATAGACGAGTCAGCGG
AAGCAACAATATCTGAGTACAGACATAAGTTAAACAAGTTTGCCTTAAGAAGGCTAGCACAAAAGTAGCAACGATCGAAAAGGCAAGGCCTCCTGCCTGG
GACCTCCTAGCTACTCCTCGAAGCCGAACTCCATGTAGAATCATCCTCGGGATCTCTAGCTCCTGGACTCCAGCATCTGGTTGCTCAGACAAGAAGGAGG
GGTCGTCAGTGACGTAGTCGACCACAGGGCATCAGCATCGTCACGGGGTTGTGATGCAGATGGTGAGGTCGGGGAGAGTCGGGGTTGACCGGAACGACGG
TAATCGATGACGGACGACGACGACGTACGCGACGAAGTCTGGCTCGATGGCGAGCGCACGGGCCACCTCGGCTCCGTTCCGTGTTCGGGACGGATGAAGA
CGTCCATGGCGGGCCTCCTGGACGTCCTCCCACGCGAAGGCGACGACGGTGGTCGTGGTAATGACGATGACGAGCGCGGTCACCGTGAGAGTTTCCAAGC
TCGAATTCGAGCGAAAGAA
page-top