Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18849  (registered. 2007)
Contig Information
Length 1051 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VABA Shoot with ABA treatment 1
Wh_VWD Shoot grown with dessication 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=V-type proton ATPase subunit B 2; Short=V-ATPase subunit B 2; AltName: Full=Vacuolar proton pump subunit B 2 >gi|167110|gb|AAA81331.1| vacuolar ATPase B subunit [Hordeum vulgare]
Score 1076
Evalue 2.65833e-115
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18849
AACTAATATAAGAGCCTGGTAGATCACTACTTTAGTGATCTATACGCTCTTATATTAGTTCGCGGAGCGAGTATCAATCAATTTACTTAAAAGCCTTAAC
AAAGAACAAATCAATATTGTTTACATTTTCCACAAGTCCAAAAATATATAACTAACATCTTCGGGCATGTACGCGCCTAAACGGCTTTTCAGTTTTGCTG
CACAATACAGGGAAATGAAACCAGAAAGAGGTCTAGCTTGTGAATGGAAGCTACATGGGATTACAAAGCTGCCAGTGCACAAGACATGTGGGGTACAACT
TGTGCATACAGACTGGAAAGAATAGGATCTGACTATATAACGTAGCAAAATGATACAAGTTTGGATTCTTCTCTTATTCAAGCTGTTCATCATGAAAAAA
ATGGACTTTTATGAACAAAATGGATCAATGGGTGGCATCTCTGCTGTAGAACTGATCCAAGGTCTTCGCAGGAATACGGTGGAGAAGTTCACGGGGGAAT
ATGCGTAGCAATGTCCATGCCAGATCAAGTGACTGAAAAATGTTCCGAGTATCGTATGCTCCTTGCGCTACAAATTTCCTCTCAAACTTATCGAGGAATT
CTAAATAGAGCAGGTCCTCAGATGAAAGAGCCTCCTCTCCGACAACTGCTTTCATGGCTTGAACATCCTTCCCAATGGCGTAGTTGGCATACAGCTGATT
GGACACATCTGAATGATCCCGGCGTGTCATACCTTCACCAATAGCACTCTTCATCAGACGAGAAAGAGATGGCAGGACGTTGATGGGTGGGTATATCTGT
CTATTATGAAGCTGTCTGTCAATATATATCTGCCCTTCGGTAATGTATCCCGTAAGATCAGGAGTTGGATGGGTGATATCATCATTAGGCATTGTAAGAA
TAGGAATTTGGGTAATTGATCCTTTTCTTCCCTCGATACGCCCAGCTCGCTCATATATGGTGGCCAGATCAGTATACATATACCCAGGATAACCACGCCT
ACCAGGTACCTCTTCTCGTGCTGCTGAGACCTCACGAAGTGCATCGGCATA
page-top