Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18839  (registered. 2007)
Contig Information
Length 766 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_VABA Shoot with ABA treatment 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_002579 [Oryza sativa (japonica cultivar-group)]
Score 506
Evalue 1.93928e-49
Total Hit Count 15
Registered year 2007
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18839
CTCTTGCTTTTTGCACCCTGCAAACAAATTACAGGTATCCATCTATTCTGACCACATCAACGGAGGTGATATCATGTCCAGTCCAGTAACAAGGTTACAC
ACCATCTAAACCACCATAACCCTGAAGAAATTAGCCGCTTCACAAGATGACTGAATGAAATGTATAGTAATGTACAGTGCTAGTGACTTCACCCACCAAA
AGAAATCCCAAAAAAATACAACTCTGGTGTCTTTTCCCTGCAGAATCTAATGGTCTGATGGTACTTGCATGACACTGGGAGGCGAACGGCGAATTTCACC
TGCTCCAAGCTTCTGATAAAAAGATGTACCGGAAGGCTTTGCTTGGAGTTTAAAGTAGTGGATTGCAGAGATATTGTGCAGAGCCAGAAAAGCTGGAGGC
AGGTGCATCACCGAGAAGGAAAATGCCCACGATCAAGAATGCCCAAATTGGGACAATACTGATTGAAACAAGGTAGAAAATGCCTCAGCAGTAGTCCCAT
CCTCGGCCTTGATTTTGAGCTGGGCCTTCGCTGATGCTGTGTTAACAATGCATTCTACAAGGTAGAAAGCAGCAGCCCCAGCTTTCTGACCATAAAAGTA
GAACTTGTAGTTTGGAGGCTGACCGCCTGAAGCAATGCATTGAATGTAGTTGCTTTGCATATGACGAATGAGCGATTGGGGATTCATCAAAGAAGCTGCT
CCTTGTGGACTTAAAGAGCATTCCTGAGAAAAGGATAATGCTAGTTGGCCCCATTTCTTCTGGAAA
page-top